ID: 1129075262

View in Genome Browser
Species Human (GRCh38)
Location 15:72989556-72989578
Sequence AATGTTAAAAACTCTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129075262_1129075265 5 Left 1129075262 15:72989556-72989578 CCAGCAACAGAGTTTTTAACATT No data
Right 1129075265 15:72989584-72989606 ATCCAGGACAGCGGCCTTTATGG No data
1129075262_1129075267 9 Left 1129075262 15:72989556-72989578 CCAGCAACAGAGTTTTTAACATT No data
Right 1129075267 15:72989588-72989610 AGGACAGCGGCCTTTATGGAAGG No data
1129075262_1129075264 -4 Left 1129075262 15:72989556-72989578 CCAGCAACAGAGTTTTTAACATT No data
Right 1129075264 15:72989575-72989597 CATTATTAGATCCAGGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129075262 Original CRISPR AATGTTAAAAACTCTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr