ID: 1129078840

View in Genome Browser
Species Human (GRCh38)
Location 15:73021839-73021861
Sequence TGACCCTTAGACCCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129078838_1129078840 -5 Left 1129078838 15:73021821-73021843 CCCAAGCACATCTGATCATGACC No data
Right 1129078840 15:73021839-73021861 TGACCCTTAGACCCCCAAAGAGG No data
1129078839_1129078840 -6 Left 1129078839 15:73021822-73021844 CCAAGCACATCTGATCATGACCC No data
Right 1129078840 15:73021839-73021861 TGACCCTTAGACCCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129078840 Original CRISPR TGACCCTTAGACCCCCAAAG AGG Intergenic
No off target data available for this crispr