ID: 1129090859

View in Genome Browser
Species Human (GRCh38)
Location 15:73148927-73148949
Sequence GGAACTACTCAGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129090859 Original CRISPR GGAACTACTCAGATGGAAGC AGG Intronic
903926252 1:26832832-26832854 GGAACTACTCAGCTCCACGCTGG - Intronic
905925675 1:41747937-41747959 GGCAGTAATCAGATGGAAGAAGG + Intronic
908083849 1:60609438-60609460 GGAACTATTCAGATGGCAAAAGG - Intergenic
912573910 1:110646577-110646599 GTAACAACTCAGATGGGAGATGG + Intergenic
913243813 1:116853864-116853886 GGAACTGCTCAGCAGGAAACAGG - Intergenic
915962831 1:160281518-160281540 GCAACTACTCAGGAGGCAGCAGG - Intronic
917164038 1:172091490-172091512 GGAACCATGCAGATGAAAGCGGG + Intronic
920664945 1:207956454-207956476 GGAACTCCTGAGATGGATGAGGG + Intergenic
920897915 1:210075812-210075834 GGAACTACTGATACGGAAGGAGG - Intronic
921335324 1:214079901-214079923 GGCACGACTCACATGGCAGCAGG - Intergenic
921352785 1:214254741-214254763 GGAACTAATCAGATAAAAGGGGG - Intergenic
923958811 1:239054010-239054032 GGATCTAGTCAGATGCAAGAAGG + Intergenic
1064307988 10:14185914-14185936 GGAACTGCAAAGATGGCAGCTGG + Intronic
1071949147 10:90683026-90683048 GGAACTACACAGATAGAGACAGG - Intergenic
1071996943 10:91158762-91158784 GGAACTACTAAAATTTAAGCTGG + Intergenic
1072316473 10:94208275-94208297 AGAAATACTCAGAATGAAGCTGG - Intronic
1074307761 10:112294833-112294855 GGAACTAATCAGATAGGAGGTGG + Intronic
1074699453 10:116080351-116080373 GAAACTTCTCATAAGGAAGCCGG - Intronic
1077677060 11:4204432-4204454 GGGGCTGCTCAGATGGATGCTGG - Intergenic
1079074429 11:17375011-17375033 GTAACTGCTCAGAGGCAAGCTGG - Exonic
1079883454 11:25955835-25955857 GGAACAAAGCAGATGGAAGAAGG + Intergenic
1079893276 11:26085412-26085434 TGAACTAGTCAGTTGGAAGTTGG - Intergenic
1080009586 11:27444256-27444278 GGGACTACTGAGAAGGAGGCGGG + Intronic
1080577731 11:33615214-33615236 GGAGTTGCTCTGATGGAAGCTGG + Intronic
1080741939 11:35073950-35073972 GGACCTTCTCACATGGCAGCAGG + Intergenic
1088356159 11:108945804-108945826 GGATCTAGCAAGATGGAAGCTGG - Intergenic
1089331313 11:117690866-117690888 GCAGCTGCTCTGATGGAAGCAGG - Intronic
1090342957 11:126041836-126041858 GGAACAACTCACATGCAAGCTGG - Intronic
1090506345 11:127319803-127319825 GGACCTTCTCACATGGAGGCAGG + Intergenic
1090917192 11:131175951-131175973 GCAAATGCTCAGATAGAAGCAGG - Intergenic
1094266535 12:28566241-28566263 GGGACTTCTCACATGGCAGCAGG + Intronic
1096669806 12:53191858-53191880 GCAACAACTCAACTGGAAGCAGG - Exonic
1099115008 12:78612997-78613019 TGAACCTCTGAGATGGAAGCAGG - Intergenic
1099806700 12:87529406-87529428 GGTACTAAGCAGATGGAATCTGG - Intergenic
1103160791 12:118727521-118727543 GGAAACACTGTGATGGAAGCTGG - Intergenic
1104128894 12:125873769-125873791 GGGACTTCTCACATGGCAGCAGG - Intergenic
1105627340 13:22125589-22125611 GGACCTACTCAAATGGGATCTGG + Intergenic
1115990260 14:39143276-39143298 GGCACTTCTCATATGGCAGCAGG + Intergenic
1116983325 14:51194141-51194163 GGCACCACTCAGAGGGAAGTAGG - Intergenic
1118763492 14:68894923-68894945 GGAATGACTAAGATGGAAGACGG + Intronic
1119979036 14:79058862-79058884 GGACCTTCTCACATGGTAGCAGG - Intronic
1120062053 14:79995311-79995333 GGCACTACTAAGATGCAAGATGG + Intergenic
1123221507 14:106861219-106861241 GGCACGTCTCAGATGGCAGCAGG - Intergenic
1123753794 15:23380632-23380654 AGAACTGCTCAGATGGAAAGTGG - Intergenic
1126919853 15:53509159-53509181 GGAACAAAGCAGACGGAAGCTGG + Intergenic
1129090859 15:73148927-73148949 GGAACTACTCAGATGGAAGCAGG + Intronic
1130406219 15:83604307-83604329 AGAACTACTCGGGTGCAAGCTGG - Intronic
1131578206 15:93613528-93613550 GGAACTAAACAGATGGAAAAAGG + Intergenic
1134675670 16:16088813-16088835 GGAGCTACTCAGAAGGCAGGAGG - Intronic
1134685809 16:16157475-16157497 GGAAGTCACCAGATGGAAGCAGG + Intronic
1137755000 16:50894177-50894199 GGAAGTACTGAGAGGGAAGTAGG - Intergenic
1138106231 16:54288299-54288321 GAAACTACTCAGATGCAGTCTGG - Intergenic
1138612623 16:58139202-58139224 GACACTACTCATAAGGAAGCTGG + Intergenic
1139162454 16:64527642-64527664 GGAATTTCTCATATGGCAGCAGG - Intergenic
1139338804 16:66253635-66253657 GGAACTACTCACATGGGGGAGGG - Intergenic
1140626647 16:76802803-76802825 GGAGCTACTCAGGTTGAAGAGGG - Intergenic
1142231266 16:88901310-88901332 GGAGCTACCCAGTGGGAAGCAGG + Intronic
1142866436 17:2794347-2794369 GGTTCTTCTCAGATGGAGGCAGG + Intronic
1144188176 17:12815914-12815936 GGAACTATTTAGAAGGAAGTGGG + Intronic
1145925860 17:28646000-28646022 TAAACTACACAGAAGGAAGCAGG - Intergenic
1146266516 17:31456863-31456885 GGGACTATTCCAATGGAAGCGGG + Intronic
1146641465 17:34544762-34544784 GGAAATCCTCAGATGGAAAAAGG + Intergenic
1147251278 17:39153934-39153956 AGAATTACTCACTTGGAAGCAGG + Intronic
1147496031 17:40916622-40916644 TGAACTTCTCACATGGTAGCTGG + Intergenic
1149110999 17:53030457-53030479 GGAAGTAATGAGATTGAAGCTGG - Intergenic
1153712562 18:7814636-7814658 GCAACTATTCAGATGGATGGTGG - Intronic
1155225077 18:23722289-23722311 GAAACAGCTCAGAGGGAAGCAGG - Intronic
1156361270 18:36386686-36386708 GGAGATACTCAGAGGGCAGCTGG + Intronic
1157112074 18:44830615-44830637 GGATTTGATCAGATGGAAGCTGG + Intronic
1159400344 18:67924004-67924026 GGAATGACTCACATGGAGGCTGG - Intergenic
1159621224 18:70641061-70641083 GGATATAGTCAGATGGAAGTGGG + Intronic
1159861468 18:73654232-73654254 GGAAATACTCAGGTGGAATTTGG + Intergenic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1165261388 19:34622121-34622143 GTAACTGCTCAGAGGCAAGCTGG + Intronic
925001338 2:405212-405234 GGACCTTCTCAGATGGCAGCAGG + Intergenic
927583206 2:24273932-24273954 GGACCTACTCAGTCTGAAGCTGG - Intronic
929033083 2:37667021-37667043 GAGACTTCTCAGATGGAAACAGG - Intronic
929793902 2:45043716-45043738 GGAAATACTGAGGTTGAAGCTGG - Intergenic
934752583 2:96803041-96803063 GGAACAGTTCAGATGGAAGAAGG - Intronic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
938852786 2:135278558-135278580 GGAGCTAATCAGAAGGAATCAGG + Intronic
939277805 2:140023341-140023363 GGAACTATTCAAATGGAGGCAGG - Intergenic
942477900 2:176348067-176348089 GGATCTAGGCAAATGGAAGCTGG - Intergenic
945790029 2:214293473-214293495 GGTACTGTTCAGATGAAAGCTGG + Intronic
948081359 2:235207797-235207819 GAAACTACCCAGAGGGGAGCAGG - Intergenic
948396923 2:237651504-237651526 GGAGCTTCCCAGATGGAAGGAGG - Intronic
948710969 2:239825333-239825355 GGAACTCCACAGATGGCAACAGG + Intergenic
1170647142 20:18207614-18207636 TGACCTACTCAGAATGAAGCAGG + Intergenic
1174598832 20:51707570-51707592 GGATCTACCCAGGTGGAAGCAGG + Intronic
1178809919 21:35872205-35872227 GGAATTGTTCAGATGGAAGAGGG - Intronic
1179563694 21:42233400-42233422 GGAAGTGCTCAGACAGAAGCTGG - Intronic
1181782892 22:25205863-25205885 GGAAGGACTCAGATGGGAACAGG - Intronic
1183606554 22:38869856-38869878 GGAACTACTCTGAAGCAAACAGG - Intronic
950146985 3:10657153-10657175 GGAGAGACTCAGGTGGAAGCAGG + Intronic
953844181 3:46414198-46414220 GGGGCTGCTCAGATGGAAACTGG - Intergenic
954784683 3:53084202-53084224 GAAAATATTCAGAGGGAAGCTGG - Intronic
954840367 3:53506261-53506283 GCAAGTACTCAGATGTAGGCAGG - Intronic
955043372 3:55337538-55337560 GGACCTGCTCAGATGGAGGTTGG + Intergenic
957470505 3:80652981-80653003 TGAAGGACTCAGAAGGAAGCAGG + Intergenic
959771510 3:110104220-110104242 GGAAGTACTTAGATGTAGGCTGG - Intergenic
959807624 3:110576068-110576090 GGAAGTAGACAGATGGAAGCAGG + Intergenic
960381972 3:116974022-116974044 GGAAATACTCAGAGGGAAGCTGG - Intronic
960692702 3:120363564-120363586 GGAGTTACTCAGATTCAAGCAGG + Intergenic
961609610 3:128126177-128126199 GGAACAACTCTGGTGGAAGTGGG - Intronic
963454722 3:145530130-145530152 GCACCTAATAAGATGGAAGCAGG + Intergenic
969199614 4:5592435-5592457 GTAACTAGTCAGATGTGAGCAGG + Intronic
969917188 4:10502280-10502302 GGACCTTCTCACATGGCAGCAGG + Intronic
970683989 4:18544350-18544372 GGAAATATTTAGATAGAAGCTGG + Intergenic
971892386 4:32541959-32541981 TGAACTACTGTGAAGGAAGCAGG - Intergenic
972402827 4:38720905-38720927 GGAACTGGTCACTTGGAAGCTGG + Intergenic
972702156 4:41504444-41504466 GGAACTGCTCAGATGCAAAAAGG - Intronic
974177788 4:58345872-58345894 GGAACATCTCACATGGCAGCAGG - Intergenic
978686433 4:111450630-111450652 GGAACATCTCAGCAGGAAGCTGG + Intergenic
978888147 4:113790624-113790646 GGAACTTCTCAGTGGGAAGCTGG - Intergenic
985013863 4:185612925-185612947 CCAACTACTCAGATGGATGCTGG - Intronic
991431198 5:66549344-66549366 GGGACTTCTCACATGGCAGCAGG - Intergenic
997583390 5:135030955-135030977 GGACCCACTCAGATGTTAGCAGG - Intronic
998855712 5:146393302-146393324 AGTTCTACTCAGATGGAAGTTGG - Intergenic
1002202452 5:177537738-177537760 GGAACTGTTCTGGTGGAAGCAGG - Intronic
1002516189 5:179760789-179760811 GGAACTTTAAAGATGGAAGCAGG + Intronic
1006856525 6:37137529-37137551 TGAACAACTCAGATTGAAGATGG + Intergenic
1007093162 6:39196937-39196959 GGGCCTAGTCAGATGGAAACAGG - Intronic
1010364972 6:75040458-75040480 GAAACTACTCACATCAAAGCTGG + Intergenic
1012160685 6:95881564-95881586 GGGACTACTCAGAGGGAGGAGGG - Intergenic
1012978073 6:105801513-105801535 GAAACTTCACAGAGGGAAGCAGG + Intergenic
1016437243 6:144049539-144049561 GGACCTTCTCACATGGAAGCAGG + Intronic
1016743476 6:147553317-147553339 TGAAGTCCTCTGATGGAAGCAGG - Intronic
1018001603 6:159583535-159583557 GATACTACACAGATGGAAGGTGG + Intergenic
1019057052 6:169231529-169231551 GGAGCTGCTCAGCTGGAAGAAGG - Intronic
1026374353 7:69735565-69735587 GGGGCTACTTAGGTGGAAGCTGG + Intronic
1026947194 7:74324385-74324407 GGAACCATTCAGATGACAGCAGG - Intronic
1027404288 7:77843471-77843493 GAAAATACTAAGATGGCAGCCGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1036448879 8:8847513-8847535 GGATCTACTCAGAAGCAGGCAGG + Intronic
1036505992 8:9356554-9356576 GGAACAAAGCAGATGGAAGAAGG + Intergenic
1037158213 8:15732391-15732413 GGCACATCTTAGATGGAAGCAGG - Intronic
1037766537 8:21775713-21775735 GGGACCACGCAGATGGAAGCTGG - Intronic
1038414050 8:27380365-27380387 GGCACAACTCACATGGTAGCAGG - Intronic
1038670747 8:29581032-29581054 GGAGCTAGTTAGATGGAGGCAGG - Intergenic
1039082515 8:33746766-33746788 GGACCTTCTCACATGGCAGCAGG - Intergenic
1039440338 8:37590803-37590825 TGACCTCCTCAGATGGGAGCAGG + Intergenic
1039943989 8:42114683-42114705 GGGACTAGTCAGATGGAGGAGGG - Intergenic
1043777583 8:84289367-84289389 GGGCCTAGTCAGAAGGAAGCAGG + Intronic
1049956418 9:697141-697163 AGAACTTTTCAGATGGAAGGAGG - Intronic
1050018808 9:1262695-1262717 AAAACTACTCAGATGGGAGCTGG - Intergenic
1050496883 9:6252276-6252298 GGGACTACTCAGATGGGGCCTGG - Intronic
1052480210 9:29014762-29014784 GGAACTTCTCAGACAGAAGGAGG + Intergenic
1053513746 9:38711519-38711541 TCACCTTCTCAGATGGAAGCTGG + Intergenic
1053585989 9:39459348-39459370 GAAACTACTCACGAGGAAGCAGG + Intergenic
1054580320 9:66905874-66905896 GAAACTACTCACGAGGAAGCAGG - Intronic
1059692608 9:116699803-116699825 AGAACTACCCAGCTGGAATCAGG - Exonic
1185496924 X:561618-561640 GGCACAACACAGATGGAAACTGG - Intergenic
1185513743 X:682773-682795 GCAACTTCTGAGATGCAAGCAGG + Intergenic
1186184052 X:7002763-7002785 GGAACTCATCAGAGGGAAGCCGG + Intergenic
1186289980 X:8086587-8086609 GGACCTGCTCACATGGCAGCAGG + Intergenic
1189549995 X:42083138-42083160 GGAACTGATCAGGTGGCAGCAGG + Intergenic
1190061825 X:47216597-47216619 GGAACAACTAAGATGCAACCAGG - Intergenic
1190713661 X:53087093-53087115 AGAAGTACTCAGATGGGAGGTGG + Intronic
1191164878 X:57378395-57378417 AGAGCTACTCTGATGGAAACAGG - Intronic
1193200264 X:78681447-78681469 GGCACTTCTCACATGGCAGCAGG - Intergenic
1193380270 X:80809440-80809462 GCACCTACCCAGATCGAAGCCGG - Exonic
1193394555 X:80968356-80968378 GGAACTAGCCAGATGCCAGCCGG - Intergenic
1193413758 X:81196894-81196916 GGACCTTCTCACATGGCAGCAGG - Intronic
1195708714 X:107757353-107757375 GGAACTGCTCTGAGGGAGGCAGG + Intronic
1199543441 X:148982716-148982738 GGAACTGCTTCCATGGAAGCTGG + Intronic
1200071917 X:153533459-153533481 GGAAGTGCTCAGAAGGAATCTGG + Intronic
1200309126 X:155059125-155059147 TGAAGTACACAGTTGGAAGCTGG + Exonic
1201476301 Y:14385606-14385628 GGACCTACTTAAATGGAACCAGG - Intergenic
1202070460 Y:20986630-20986652 GCAACCACTCAGAGGCAAGCTGG + Intergenic