ID: 1129095209

View in Genome Browser
Species Human (GRCh38)
Location 15:73199856-73199878
Sequence CTGTGTCTTCCGTGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 179}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129095205_1129095209 -3 Left 1129095205 15:73199836-73199858 CCCTATATTGGGGAGGAACACTG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1129095197_1129095209 29 Left 1129095197 15:73199804-73199826 CCTTGTTTCCAAGATGGTGCCTT 0: 1
1: 5
2: 26
3: 46
4: 242
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1129095206_1129095209 -4 Left 1129095206 15:73199837-73199859 CCTATATTGGGGAGGAACACTGT 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1129095204_1129095209 0 Left 1129095204 15:73199833-73199855 CCACCCTATATTGGGGAGGAACA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1129095198_1129095209 21 Left 1129095198 15:73199812-73199834 CCAAGATGGTGCCTTATTGCTCC 0: 1
1: 9
2: 63
3: 204
4: 671
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1129095199_1129095209 10 Left 1129095199 15:73199823-73199845 CCTTATTGCTCCACCCTATATTG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG 0: 1
1: 0
2: 2
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129095209 Original CRISPR CTGTGTCTTCCGTGGCAAAA GGG Intronic
900502984 1:3015744-3015766 CTGTGTCCTCAGTGGCAGAGAGG - Intergenic
902495680 1:16870916-16870938 CTTTGTCTGCCTTGGCAAACTGG + Intronic
903282351 1:22257265-22257287 CTGTGTCCTCCCTGGAAACATGG - Intergenic
903621635 1:24702457-24702479 CTGTGTCTTCCTCTGTAAAATGG - Intergenic
905025514 1:34846854-34846876 CAGTGTCTTCTGTGTCAAATGGG - Intronic
909784582 1:79594896-79594918 GTGTCTTTTCCGTGGAAAAATGG + Intergenic
910873588 1:91856748-91856770 CTGTCTCTTCTGAGGCCAAAGGG + Intronic
912216559 1:107620113-107620135 CTGTGAGTTCCTTGGCATAAGGG + Intronic
914376646 1:147078585-147078607 CTGTCGCTTCAGTGGCAAGAAGG + Intergenic
914958374 1:152184815-152184837 CTGTCTCCTCAGTGGCAATACGG - Intergenic
916324462 1:163541573-163541595 CACAGTCTTCAGTGGCAAAAAGG - Intergenic
919516990 1:198538018-198538040 CTGTGGCTTCTGAGGCAAAGAGG + Intronic
1064210649 10:13358089-13358111 TAGTATCTTCCGTGGCAAAAAGG + Intergenic
1064575778 10:16745061-16745083 CTGCCTCTTCCCTGTCAAAAGGG + Intronic
1065678627 10:28205983-28206005 CTGTGTCATCCATGGCAGAAAGG - Intronic
1066316764 10:34255153-34255175 CTGTGTGGTCTGTGGCAGAAAGG - Intronic
1066559620 10:36655527-36655549 CTGTGTCTTCTTTGGAGAAATGG - Intergenic
1071990956 10:91100490-91100512 CTATGTCTTCCATGGCAAGCAGG - Intergenic
1073139489 10:101237990-101238012 CAGTTTCTTCTTTGGCAAAATGG - Intergenic
1074108989 10:110409240-110409262 CAGTGCCTACCGAGGCAAAACGG + Intergenic
1075515587 10:123105564-123105586 ATGTTACTTCCATGGCAAAAGGG + Intergenic
1075667664 10:124242663-124242685 CTGTTTCCCCTGTGGCAAAACGG - Intergenic
1076802802 10:132839246-132839268 CTGTGTCTCCCGTGGCCACAGGG + Intronic
1077011945 11:382770-382792 CTGTGGCTGCCGTAGCAAATTGG + Intergenic
1077905276 11:6528165-6528187 CTGTGTTCTGCCTGGCAAAATGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080840748 11:35981358-35981380 CAGTGTCTTCATTTGCAAAATGG + Intronic
1081263754 11:40993569-40993591 CTGTGTCTCCTCTGCCAAAAAGG - Intronic
1086748760 11:90463526-90463548 CTGTGTCTTCACAGACAAAAGGG + Intergenic
1088059187 11:105625185-105625207 CTGTGACTTCCGTGACAACGAGG + Intronic
1090589854 11:128253999-128254021 CTATGTCTTTTGTGGCAATATGG + Intergenic
1090621552 11:128565251-128565273 CTGTGTCCTCAGTGGCGGAAGGG - Intronic
1090647330 11:128776642-128776664 CTCTGTCTTCAGAGGAAAAAAGG + Intronic
1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG + Intergenic
1093834682 12:23813684-23813706 CTCTTTCTTCTGTAGCAAAATGG - Intronic
1093897110 12:24586251-24586273 CTGTGTTTTCCATGAAAAAATGG - Intergenic
1096901006 12:54882296-54882318 ATGTGTGTTCAGTGGCAAAGAGG + Intergenic
1101681480 12:106971261-106971283 CTGTGCCTTCCATGGGAATAGGG + Exonic
1102971537 12:117171613-117171635 CTGTTTCTTCCTTGGTAAAATGG - Intronic
1103700330 12:122845862-122845884 CTGTGTCTTTCCTCGCAAAGAGG + Intronic
1110400020 13:75079149-75079171 CTGTGTATCCCATGACAAAAGGG - Intergenic
1115070693 14:29318581-29318603 CTGTGTCTACCTTGGCAAATAGG + Intergenic
1120385081 14:83834616-83834638 CTGTGTCTCGCATGGCAGAAAGG + Intergenic
1121587295 14:95070941-95070963 CTGTGTCTTGAGGGGCAAATAGG + Intergenic
1121605421 14:95236675-95236697 CTCTGTCTTCTGTGGGAGAAAGG - Intronic
1122017373 14:98807706-98807728 CTGTGTCTTCATTTGTAAAATGG + Intergenic
1124425566 15:29559818-29559840 CTGTGTCTCACATGGCAAAAAGG - Intronic
1125418189 15:39474978-39475000 CTGTGTCTGCTGGGGCAAAGAGG + Intergenic
1126799634 15:52287340-52287362 CTGTGTAGCCCGTGGCAACAAGG - Intronic
1129095209 15:73199856-73199878 CTGTGTCTTCCGTGGCAAAAGGG + Intronic
1132413992 15:101607621-101607643 ATGTATCTTATGTGGCAAAAGGG + Intergenic
1132676876 16:1124604-1124626 CTCAGTCTTCCCTGGCAACAGGG - Intergenic
1135003679 16:18800269-18800291 CTGTTTCCTCCTTGGTAAAATGG - Intronic
1137025983 16:35475075-35475097 CTGTGTCTTCAATGGCAGAAGGG - Intergenic
1137788766 16:51156632-51156654 CTGTGTCTTCTGTTGGAAATAGG + Intergenic
1137914207 16:52411120-52411142 CTGTCTCTTTGGTGGCAAGATGG - Intergenic
1139493088 16:67297581-67297603 CTGTGCCTTCCTAGACAAAAGGG - Exonic
1142524580 17:530952-530974 CTGTGTCTGCCTTGCCACAAGGG - Intronic
1143111094 17:4553285-4553307 CTTTCTCTTCGGTGACAAAAGGG + Intronic
1143416548 17:6755128-6755150 CTCTGTTTTCCATAGCAAAATGG + Intergenic
1145845398 17:28034148-28034170 CTGTTTCTTCATTTGCAAAATGG + Intergenic
1145956868 17:28860717-28860739 CTGTGTCTTCTGTTGGAAGAAGG + Exonic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1147739567 17:42663260-42663282 CTGAGTCTTCAGAGCCAAAAAGG - Intronic
1148661738 17:49339759-49339781 CTCTGTCTTCAGTGGCACAGCGG - Intronic
1148887782 17:50786264-50786286 CAGTCTCTTCCTTGGAAAAATGG - Intergenic
1150223246 17:63508947-63508969 CTGGGTCTTCTTTGGCAAAACGG - Intronic
1153926467 18:9839295-9839317 CTGTGGCTTCGGGGGCAAACAGG + Intronic
1154241402 18:12657406-12657428 GGGGGTCTCCCGTGGCAAAATGG + Intronic
1156197947 18:34797132-34797154 CTGTGTCTTCAGGGACAGAATGG - Intronic
1157473866 18:48009188-48009210 CAGTGTCTTCAAGGGCAAAAGGG - Intergenic
1158073997 18:53507608-53507630 CTTTATCTTCTGTGGTAAAAGGG + Intronic
1158745661 18:60196784-60196806 CTGTGTTTTCACTGGGAAAACGG - Intergenic
1160253584 18:77226655-77226677 CAGTTTCTTCATTGGCAAAATGG - Intergenic
1160391508 18:78537463-78537485 CTGTGTTTTCAGTGTCAGAAGGG - Intergenic
1160805931 19:992151-992173 CGGGGTCTTCCGGGACAAAAGGG - Intronic
1161037545 19:2093799-2093821 CTGTGTCGTCCCTGGGGAAAGGG + Intronic
1161341182 19:3743368-3743390 CTGTTTCTTCAGTGGTAAAATGG + Intronic
1162257050 19:9498866-9498888 CGGTGGCTTCGGTGGCAGAATGG + Intergenic
1163049693 19:14673037-14673059 CTCTGTCTCCAGTTGCAAAAAGG + Intronic
1163153094 19:15426153-15426175 CTGTTTCCTCCGCTGCAAAATGG + Intronic
1165094278 19:33402079-33402101 CTGTGTCTTCCAGGGAAAAAGGG + Intronic
1166463474 19:43011028-43011050 CTGTCTTTTCATTGGCAAAATGG - Intronic
925113284 2:1354253-1354275 CTGGGTGTTCCGTGGCAGAGCGG + Intronic
925113308 2:1354359-1354381 CTGGGTGTTCCGTGGCAGAGCGG + Intronic
925113330 2:1354466-1354488 CTGGGTGTTCCGTGGCAGAGCGG + Intronic
925348595 2:3186906-3186928 CAGTGGCTTCCGTCTCAAAAAGG + Intergenic
926505858 2:13714824-13714846 TTGTGTATTCAGTGGCACAATGG - Intergenic
931636202 2:64342565-64342587 CTATGTCCTCTGTGGCAGAAAGG - Intergenic
931975912 2:67644097-67644119 GTTTGTCTTCAGGGGCAAAAAGG + Intergenic
933774452 2:85763765-85763787 CTGTTTCTTCCCCTGCAAAATGG + Intronic
936731515 2:115386702-115386724 CTGTCTCTTCTTTGGCAAAGAGG + Intronic
937363296 2:121243898-121243920 CCCTCTCTTCCGTGGAAAAACGG + Intronic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
942780914 2:179641799-179641821 CTGTGGCTTCTGGGACAAAAGGG - Intronic
943224048 2:185145369-185145391 CTGTGTCATGAGTGACAAAAGGG + Intergenic
943759523 2:191592985-191593007 CGTTATCTTACGTGGCAAAAAGG - Intergenic
943778395 2:191793448-191793470 AGTTGTCTTACGTGGCAAAAGGG - Intergenic
944192582 2:197019488-197019510 CTGTGTCATCCTGGGCAAAATGG - Intronic
944362616 2:198875957-198875979 CTCTGTCCTCCGTGGGATAAAGG + Intergenic
946617488 2:221525619-221525641 CTGTGGCTTCCTCAGCAAAATGG + Intronic
947807048 2:232976288-232976310 CTGTGTCTTCCTTTGTGAAATGG + Intronic
948091309 2:235298214-235298236 GTGTTTCTTCTGTGGCAACATGG + Intergenic
948398613 2:237666102-237666124 CTGTGCCTTCCTTGGAAAAATGG + Intronic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1169364268 20:4978581-4978603 CTGTGTCTTCCATTGCCAATGGG - Intronic
1175089764 20:56492729-56492751 CTGTTTCCTCCCTTGCAAAATGG - Intronic
1175207059 20:57319134-57319156 CTGTTTCTTCCTCTGCAAAATGG + Intergenic
1175371655 20:58496609-58496631 CTGTGTCTTCCTTGGCCACATGG - Intronic
1177040863 21:16108800-16108822 CTGTGTCTTACGCAGTAAAAGGG + Intergenic
1177773333 21:25541374-25541396 CAGTGTCTTCCTTTGCACAATGG - Intergenic
1178662992 21:34522510-34522532 CTGTGCCTCCCAGGGCAAAAAGG + Intronic
1178694477 21:34781135-34781157 CTGTGTCTTACGTGGTGGAAGGG + Intergenic
1179422310 21:41246581-41246603 CTTTGTCTTCTGTGAAAAAATGG - Intronic
1181364473 22:22364484-22364506 TTGTGTCTTCCAGGGGAAAAGGG - Intergenic
1181904184 22:26180262-26180284 ATGTGTCTTAACTGGCAAAAGGG - Intronic
1182161980 22:28131996-28132018 CTGTGGCTTACTTGGCATAATGG - Intronic
1182446149 22:30390712-30390734 CTGTGTCCTCAGTTGTAAAATGG + Intronic
1183105560 22:35612646-35612668 CTGTTTCTTCCTCTGCAAAATGG - Intronic
1183769802 22:39914164-39914186 CTTTGTGTTCCATGGCAAAAGGG - Intronic
1184420748 22:44381595-44381617 CAGTGTCCTCAGTGGTAAAATGG + Intergenic
1185133661 22:49056086-49056108 TTGTGTCCTCAGTGGCAGAAGGG - Intergenic
949267368 3:2174186-2174208 CTGTCTTTTCCGTGGAAAAGAGG + Intronic
950182990 3:10928054-10928076 CTGTGTCTTCATTTACAAAATGG + Intronic
950895271 3:16443902-16443924 CTGTGTCTTCTCTGACAAAATGG - Intronic
951148146 3:19254304-19254326 CTGTGTGTTCCCTGCAAAAAAGG + Intronic
952796355 3:37242829-37242851 CTGTGTCTTCGGTGCCAGAGGGG - Intergenic
955767875 3:62363776-62363798 CTGTGTCTTCATCTGCAAAATGG - Intergenic
955914846 3:63896561-63896583 CTGTTTCTTCAGTAGTAAAATGG + Intronic
960171913 3:114472362-114472384 CTGGGTCCTCCCTGGGAAAAAGG + Intronic
961001106 3:123374673-123374695 ATTTGTCTTCTTTGGCAAAAGGG + Intronic
962331089 3:134479068-134479090 TTGTTTCTTCCTTGGCAAATGGG + Intronic
962902899 3:139776402-139776424 ATGTGTCTTCCCAGGCAGAAGGG - Intergenic
964085158 3:152808304-152808326 CTGTGTGTTGGGTGGCATAATGG + Intergenic
964670674 3:159221784-159221806 CTGTCACTTCCCTGGCAGAAAGG - Intronic
965706765 3:171516434-171516456 CTGTTTCTTCCAAGGTAAAATGG - Intergenic
967226147 3:187293255-187293277 CTGTGTCTTCATTTGGAAAATGG + Intergenic
968137738 3:196231150-196231172 CTGTTTCTTCCTTTGTAAAATGG - Intronic
971217459 4:24674330-24674352 CTGTCTCCTCTGTGCCAAAAAGG - Intergenic
975640959 4:76499996-76500018 CTGTCTCCTCTTTGGCAAAATGG - Intronic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
981409365 4:144410615-144410637 CTGTGTCTTCATTTGCAAAGTGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990622617 5:57577182-57577204 CTGTTTCTTCAGTTGTAAAATGG + Intergenic
991363257 5:65842820-65842842 ATGGGACTTCAGTGGCAAAAGGG - Intronic
992056113 5:72992513-72992535 TTGGCTCTTACGTGGCAAAAGGG + Intronic
992387112 5:76295278-76295300 CTGTGTCCTCAGTGGTAGAAGGG + Intronic
993200095 5:84804881-84804903 CTGAGTCCTCGGTGGCACAAGGG + Intergenic
995088536 5:108143838-108143860 TTGTGTTTTCCTTGCCAAAATGG - Intronic
995654964 5:114415680-114415702 GTGTATCTTCTTTGGCAAAATGG + Intronic
997024088 5:130037337-130037359 CTGTACCTTCCTTGGCAAGAGGG - Intronic
998421868 5:141994910-141994932 CTGTGTCATACGCTGCAAAAAGG + Intronic
999748958 5:154611898-154611920 CTGTGTCTTCCACTGCGAAATGG + Intergenic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
1000703691 5:164485322-164485344 CTGAAACTTCCTTGGCAAAATGG - Intergenic
1002758885 6:186551-186573 CTGTGTTTTCAGTTGAAAAATGG - Intergenic
1004130655 6:12916052-12916074 CTCTGTAATGCGTGGCAAAAAGG + Intronic
1004338742 6:14788353-14788375 CAGTGTGATCCGTGGCCAAATGG + Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1009003398 6:57749055-57749077 ATGTGTCTTCAGAGGCATAAGGG - Intergenic
1009378044 6:62995580-62995602 CTCTGTCTCTCCTGGCAAAATGG - Intergenic
1010113201 6:72267723-72267745 CTGTGGCTTCAGTGTCACAAGGG - Intronic
1011759152 6:90541467-90541489 GCGTGTCTTCCTTGGTAAAAAGG + Intronic
1012520157 6:100111571-100111593 CTTTGTCTTTGGTGGAAAAAGGG + Intergenic
1012853900 6:104478557-104478579 CTGTGTCCTGCATGGCAGAATGG + Intergenic
1013591944 6:111626252-111626274 CTGTTACTTCCCTGGAAAAAGGG - Intergenic
1014004559 6:116403223-116403245 ATGTGTGTTCCTTAGCAAAAGGG - Intronic
1015019256 6:128452372-128452394 CTGTGTCTTCCCTTCCAAATGGG + Intronic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1016312865 6:142753418-142753440 CTGCCTCTTCCGTGGCAATCCGG + Exonic
1018403700 6:163454102-163454124 CTGTGTCCTCCTTGGGAGAAAGG - Intronic
1019062314 6:169265358-169265380 CTGTGTTTTCCGTGGCATGCTGG - Intergenic
1024049875 7:45611881-45611903 TTGTGTCTTCAGAGGCCAAATGG - Intronic
1034655410 7:152725348-152725370 CAGTGTCTTCAGTGGATAAACGG - Intergenic
1035416303 7:158690618-158690640 CTGTGTCTTCCTTGGCAGGCAGG + Exonic
1035478334 7:159159484-159159506 CTGGGTCTCCAGGGGCAAAAGGG - Intergenic
1036693335 8:10958626-10958648 CTGTGTCTTCCTCTGTAAAAGGG - Intronic
1037453807 8:19043739-19043761 CTGTGTCATCTGTGGCAAAAGGG - Intronic
1038464542 8:27749132-27749154 CTGTGTTTTCTTTGGTAAAAGGG - Intronic
1042100767 8:65272788-65272810 CTCTGTCTTCAGTGGCAGCAGGG - Intergenic
1043447134 8:80330078-80330100 CTGTTACTTCCTTTGCAAAATGG + Intergenic
1045282164 8:100758554-100758576 CTGTCTCTTCAGTGGCAAAATGG + Intergenic
1049543564 8:143219295-143219317 ATGTGCCTTCTATGGCAAAAGGG - Intergenic
1050071018 9:1814196-1814218 CTGTGACTTCCATGTCATAATGG + Intergenic
1051505965 9:17828155-17828177 CTGAGTCTTACCTAGCAAAAAGG - Intergenic
1056270114 9:84939288-84939310 CTGTTTCTTCATTGGCAAAATGG - Intronic
1058040473 9:100296401-100296423 CTGTGTCTTTGGTGACGAAAGGG - Intronic
1058100343 9:100912542-100912564 CTGGGGCTTCCCTGGCCAAAAGG + Intergenic
1059104517 9:111500264-111500286 TTGTGTCTTCACTGGCAGAAGGG + Intergenic
1059112507 9:111570439-111570461 CTGTTCCTTACATGGCAAAAAGG + Intronic
1059698836 9:116755657-116755679 ATGTATCTTATGTGGCAAAAGGG + Intronic
1059951463 9:119466709-119466731 CTTTGTGTTCTGGGGCAAAAAGG + Intergenic
1060582807 9:124767291-124767313 TTCTGACTTCCGTAGCAAAAAGG - Intronic
1185476265 X:417329-417351 CGGGCTCTTCTGTGGCAAAAGGG - Intergenic
1190944214 X:55075205-55075227 CCGTGGCTTCCGAGGGAAAAGGG + Intronic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1192325724 X:70130420-70130442 CTGTCTCTTCCGTGGAACTATGG + Intergenic
1194737138 X:97525825-97525847 CTGTGTCATCAGTATCAAAAAGG - Intronic
1200841828 Y:7789763-7789785 CTGTGTCTTCTCTGACAAAATGG - Intergenic