ID: 1129096382

View in Genome Browser
Species Human (GRCh38)
Location 15:73213164-73213186
Sequence AGCAACCACTGGAGGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129096379_1129096382 -7 Left 1129096379 15:73213148-73213170 CCTACAGCAGTAGTTGAGCAACC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1129096382 15:73213164-73213186 AGCAACCACTGGAGGTTTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129096382 Original CRISPR AGCAACCACTGGAGGTTTTC AGG Intronic
905510635 1:38517087-38517109 AGCAACCACTGGAGGGGTGGAGG - Intergenic
906519640 1:46459465-46459487 AGCATCCACTGCAGACTTTCTGG - Intergenic
906807831 1:48796523-48796545 AGGAAGCACTGGAGGTTGTGGGG + Intronic
907845438 1:58201665-58201687 AGCAAGCACTGGGGGATTCCTGG + Intronic
910260633 1:85290360-85290382 ACCAACCACTCGTGGTTATCTGG + Intergenic
910413565 1:86972635-86972657 AGCATCCACTGGGGGTCTTGGGG + Intronic
911668092 1:100577182-100577204 TGCAACCACTGAAGGTTTCGTGG + Intergenic
911870475 1:103090970-103090992 AACAACCTCAGGAGGTTTCCTGG + Intronic
915238085 1:154500726-154500748 CGGACACACTGGAGGTTTTCTGG - Intronic
917901474 1:179547216-179547238 AGCAAGCACTGCAGTTTTGCAGG - Intronic
920436860 1:205952570-205952592 AGCAAGCATTGGAGGTCTTTTGG + Intergenic
1063919317 10:10916207-10916229 GACAAACACTGGAGCTTTTCAGG - Intergenic
1067018399 10:42774369-42774391 AGCAACCTCTTGAAGTTTCCTGG + Intergenic
1069605587 10:69736963-69736985 AGTGACCTCTGGAGGCTTTCTGG - Intergenic
1070402544 10:76066193-76066215 ACCAACTACTGTAGGGTTTCTGG + Intronic
1070887607 10:79918827-79918849 AGCAACCACTGGGGAATATCAGG + Intergenic
1072174101 10:92898742-92898764 AGCTACCACTGCAGTTTTTATGG + Intronic
1073091775 10:100947081-100947103 ACCAACCACAGGAGGTTGTGGGG - Exonic
1074138627 10:110650699-110650721 AGCAGCAATTGGAGGTTTCCAGG - Intronic
1074777684 10:116778335-116778357 AGCACCAGCTGGAGGTTTTGGGG - Intergenic
1075312805 10:121429073-121429095 AGCACCCACTGCAGATATTCAGG + Intergenic
1078774036 11:14377689-14377711 TGTATCCACTGGAGGTTATCTGG + Intergenic
1079584657 11:22110951-22110973 TGCAAAGACTGGAGTTTTTCAGG + Intergenic
1080633617 11:34104483-34104505 AGAAACCACTGGAGTTTGTGGGG - Intergenic
1083520273 11:63303955-63303977 ATCAACCTCTGGATGTTCTCTGG + Intronic
1084932821 11:72570702-72570724 TGAACCCACTGGAGGCTTTCAGG - Intergenic
1089958880 11:122598421-122598443 GGGAACCACTGCAGGTTTGCAGG + Intergenic
1090522748 11:127496475-127496497 TGCAACCACTAGAGACTTTCAGG + Intergenic
1094610111 12:31987599-31987621 AGCAAATACTTTAGGTTTTCTGG + Intronic
1099955519 12:89349926-89349948 AGCTAACAATGGAGGTATTCAGG + Intronic
1100774539 12:97959828-97959850 TGTAACTACTGGAGGATTTCAGG + Intergenic
1103752152 12:123172179-123172201 AGTAAACACTTGAGGTTTTATGG + Intronic
1104444392 12:128822199-128822221 AGGAACCACTGCAGCTCTTCAGG - Intronic
1104793841 12:131502317-131502339 GGCAACCACTGGAGATATTTTGG - Intergenic
1105640135 13:22253262-22253284 AGGAACAACTGGAGTATTTCAGG + Intergenic
1105778319 13:23682900-23682922 AGCAACCACTTGAACTTTTCAGG + Intergenic
1107191204 13:37588839-37588861 AGGAACCACTGAAGATTTTGTGG + Intronic
1110476015 13:75914744-75914766 ACCAGCCACTGGAGGTATTCTGG + Intergenic
1112097720 13:96152743-96152765 AGAAGCCATTGGAGGTTTTGGGG - Intronic
1115208713 14:30942567-30942589 AGCAACAACTGGAGGTTCAAAGG + Intronic
1117014759 14:51507436-51507458 AGAATCCACTGGAGGATATCTGG + Intronic
1118288207 14:64496819-64496841 AGGAGCCACTGGAGGTTTCATGG - Intronic
1118290616 14:64518376-64518398 TGCAACCACTGCACCTTTTCTGG - Intronic
1120716652 14:87847833-87847855 AACATCCAGTGGAGGGTTTCTGG - Intronic
1122589878 14:102840951-102840973 AGTAACCATTGTAGGTTTTGGGG + Intronic
1122724937 14:103744156-103744178 AGCAACAACAGGAAGTTTTATGG + Intronic
1124073745 15:26421570-26421592 AGTAAACACTGGTGGTTTCCAGG - Intergenic
1125933166 15:43614272-43614294 ACCAGCTGCTGGAGGTTTTCTGG + Exonic
1125946264 15:43713734-43713756 ACCAGCTGCTGGAGGTTTTCTGG + Intergenic
1127295770 15:57607566-57607588 AGCAACCACAGGAGGGTGTCTGG - Intronic
1127969753 15:63949123-63949145 AGCCACAACTGTGGGTTTTCTGG - Intronic
1129096382 15:73213164-73213186 AGCAACCACTGGAGGTTTTCAGG + Intronic
1129406136 15:75319629-75319651 AGCAACCTCTGTAAGATTTCTGG - Intergenic
1129637264 15:77333367-77333389 AGAAACCAATGGTGGTTTTGTGG + Intronic
1129876727 15:78980423-78980445 AGCAAACTCTGGAGTTTCTCTGG + Intronic
1130019189 15:80212977-80212999 GGAAACCAATGGAGTTTTTCTGG + Intergenic
1131887069 15:96927497-96927519 AGTAATCAGTGGTGGTTTTCTGG + Intergenic
1133563896 16:6974763-6974785 TGCAAACACAGGGGGTTTTCTGG - Intronic
1137311329 16:47262738-47262760 ATGAACCAGTGCAGGTTTTCTGG + Intronic
1137543272 16:49378977-49378999 AGCAACCCCTGGCAGGTTTCAGG - Intronic
1137633820 16:49968206-49968228 AGCAATTGCTGAAGGTTTTCAGG + Intergenic
1143402093 17:6652510-6652532 AGCCAGCACAGAAGGTTTTCAGG + Exonic
1146072461 17:29695846-29695868 AGCACCCACTGGCTGTTTTTGGG + Intronic
1148814986 17:50321225-50321247 AGGAACCACTGGAAGAGTTCTGG - Intergenic
1150827751 17:68491700-68491722 AGCAACCTCTGGAGGACTTGGGG + Intergenic
1151034871 17:70787028-70787050 AGCAGGCACTGGTTGTTTTCTGG + Intergenic
1156690839 18:39704854-39704876 AGAAACCATTGAAGGTTTTGAGG - Intergenic
1158573008 18:58612644-58612666 AGACACCACTGGAGCTTTGCAGG + Intronic
1159437624 18:68439221-68439243 AGCACCCTGTAGAGGTTTTCTGG + Intergenic
925626548 2:5847098-5847120 AGCAACCTGTGGGGGTTTTCCGG + Intergenic
930075949 2:47405740-47405762 AGAAAACACTGGAAGTTTTTGGG + Intronic
934691577 2:96364695-96364717 TGAATCCAGTGGAGGTTTTCTGG + Intronic
936835924 2:116709478-116709500 AGAAACCTATGGAGCTTTTCAGG - Intergenic
940468652 2:154064710-154064732 GGCTACCACTGGTGATTTTCAGG - Intronic
940886614 2:158995440-158995462 AACAGCCACTTGAGGTTATCTGG + Intronic
941826687 2:169906517-169906539 AACAACCACTGGAAGGTTTGTGG - Intronic
944911371 2:204313611-204313633 AGCCACAACTGGATTTTTTCTGG - Intergenic
946505749 2:220298971-220298993 AGGAGCCATTGGAGGTTTGCGGG + Intergenic
947871670 2:233442103-233442125 AGAAACCATTGGTGGTTTTGGGG + Intronic
948648742 2:239425747-239425769 AGTAATCACTGGAGGTTTGAAGG + Intergenic
1175260069 20:57668640-57668662 AGCAAACTCTGGATATTTTCAGG + Intronic
1175604745 20:60303531-60303553 TGAAACCAAGGGAGGTTTTCTGG - Intergenic
1177094472 21:16815475-16815497 TGAAACCACTGAAGGTTTTCAGG - Intergenic
1181525490 22:23482748-23482770 GGAAAGCACTGGAGCTTTTCTGG + Intergenic
1183354875 22:37352816-37352838 AGTAGCCACTGGAGGCTTTGTGG + Intergenic
1184408327 22:44312722-44312744 AGCAGCCTGTGGAGGTTTCCAGG - Intronic
1185316898 22:50183225-50183247 AGCAGCCAGAGGAGGGTTTCTGG - Intergenic
1185393800 22:50576828-50576850 AGCAGCCAGTGGAGGGGTTCAGG - Intronic
949905738 3:8856894-8856916 AGCAACCACAGGATGAGTTCAGG - Intronic
951685970 3:25345207-25345229 TGTAACCTCTGGAGGTTTTTTGG + Intronic
953550260 3:43896757-43896779 GGCAGCCACTGCAGGTCTTCGGG - Intergenic
953604364 3:44401264-44401286 ATAAACCACTGGAGATTTGCTGG - Exonic
954847955 3:53576313-53576335 GGCAACCAATGAAAGTTTTCTGG + Intronic
960960136 3:123064888-123064910 GGAAACCACTGGAGGGTTTCAGG + Intergenic
961325612 3:126107556-126107578 AGCAAAGACTTGAGCTTTTCTGG + Intronic
961409046 3:126704882-126704904 GGAACCCACTGGAGGGTTTCAGG - Intronic
961507211 3:127378031-127378053 TGCAAGCACTGGAGGTTTTCAGG + Intergenic
966236191 3:177704342-177704364 AACAAGCTCTGCAGGTTTTCTGG - Intergenic
968230204 3:197001348-197001370 AGCACCCACTGTAGGGTCTCTGG + Intronic
969874326 4:10124679-10124701 AACAACCACTGGAGCATTTGAGG + Intergenic
970400170 4:15709594-15709616 AGAAATAACTGGTGGTTTTCTGG - Intronic
971506653 4:27373727-27373749 AGAAGCCACTGAAAGTTTTCTGG - Intergenic
978971150 4:114807680-114807702 AGCCACCAGAGGAGGATTTCGGG + Intergenic
979082762 4:116363183-116363205 AGCAGCCACTGGATGTCTTTTGG - Intergenic
980658382 4:135820994-135821016 GGTAGCCATTGGAGGTTTTCTGG + Intergenic
982661203 4:158209420-158209442 ACCAACCACTGGATGGTCTCGGG + Intronic
983049689 4:163031520-163031542 CGCAACCACTGTAGTATTTCAGG + Intergenic
984726143 4:183023307-183023329 AGCATCCACATGAGGTTTCCTGG + Intergenic
984924876 4:184797835-184797857 AGCAAGGACTTGAGTTTTTCTGG - Intronic
986925681 5:12746004-12746026 AGCAAACACTGCAAGTTTTGTGG - Intergenic
989537952 5:42585507-42585529 AGAAAACACAGGAGGTTTTTTGG - Intronic
993459600 5:88166845-88166867 AGCAACCACTAAATGTTTGCTGG + Intergenic
997476850 5:134147547-134147569 GTCCACTACTGGAGGTTTTCTGG - Exonic
997529117 5:134571351-134571373 AGAAGCCACTGGAGGTTTTAAGG + Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001280757 5:170384730-170384752 ATCAACCACTTGAGATTTTAAGG - Intronic
1001447297 5:171795435-171795457 AGCAAGCACTGCAGTTTTCCAGG + Intergenic
1003330579 6:5125218-5125240 AGAAACCACTGGAGGTTTCTGGG - Intronic
1007445854 6:41905209-41905231 ATCAACTTCTGGAGATTTTCAGG + Intergenic
1007755928 6:44099557-44099579 GGGAACCACTGGAGGTTTCAGGG + Intergenic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1010197800 6:73257360-73257382 AGCAACCAATTGAGGGTGTCTGG + Intronic
1010853449 6:80806909-80806931 AGAAACACCTGGAGGTTTGCTGG + Intergenic
1011221808 6:85062635-85062657 ATTAAACATTGGAGGTTTTCTGG - Intergenic
1011511184 6:88102997-88103019 ATCAACCATTGGAGGTGTGCTGG + Intergenic
1011985359 6:93436874-93436896 AGCACACACTGGGGCTTTTCGGG + Intergenic
1012198662 6:96377249-96377271 AGCAACCACAGGAAGTTATAGGG - Intergenic
1014859168 6:126442626-126442648 AGTAACCACTAGGGGTTTTGGGG - Intergenic
1017580927 6:155864565-155864587 AGGAACCTCTGTAGGTATTCAGG + Intergenic
1017728823 6:157296361-157296383 AGCACCCCCTGGAGGTGTGCAGG - Intronic
1019207426 6:170374216-170374238 AACAACCAATGGAGGATTTGAGG - Intronic
1021435285 7:20606614-20606636 GGCAACCACTGGGGTTTGTCAGG - Intergenic
1022275704 7:28853943-28853965 CGCACCCACGGGAGGATTTCAGG + Intergenic
1024509604 7:50193059-50193081 GGCATCCACTGGGGGTCTTCAGG - Intergenic
1027981811 7:85234141-85234163 AGCTTCCACTGAAGCTTTTCAGG + Intergenic
1028096335 7:86765465-86765487 AGCAATCACTGGAGTTTGTCAGG + Exonic
1028426154 7:90691595-90691617 GGAAACCATTGGAAGTTTTCAGG + Intronic
1031111217 7:117611301-117611323 GGCTACCACTGGGAGTTTTCTGG - Intronic
1032190826 7:129764689-129764711 AGCACCCACTGGAGCTTGTCAGG - Intergenic
1034135451 7:148763704-148763726 GGCATACACTGGAGGTTTTGTGG - Intronic
1036224506 8:6946189-6946211 AGCAACCACTTCAAGTTTTTGGG + Intergenic
1036650705 8:10641338-10641360 AGCGACCCCTGGGGGTTCTCTGG + Intronic
1037764803 8:21766063-21766085 AGAAACCACTGGAGGCATTGAGG - Intronic
1038167177 8:25097112-25097134 AACACGCACTGGGGGTTTTCAGG + Intergenic
1038370729 8:26987194-26987216 AAAAACCACTTGAGCTTTTCTGG - Intergenic
1038465603 8:27759850-27759872 AGGAGCCTCAGGAGGTTTTCCGG + Intronic
1042372114 8:68003813-68003835 AGCCTCCACAGGAGGTCTTCTGG + Intronic
1042632083 8:70829345-70829367 ATGAACTGCTGGAGGTTTTCAGG + Intergenic
1045582718 8:103499092-103499114 AGCGACCACTGGAGGCTGTGAGG - Intergenic
1046904122 8:119554057-119554079 ATCAACCACTGTATATTTTCAGG - Intergenic
1047126564 8:121968686-121968708 AGCAACCACTGATTTTTTTCCGG - Intergenic
1048405239 8:134112610-134112632 AGCTACCAGCGGAGGGTTTCTGG - Intergenic
1051130360 9:13853417-13853439 AATACCCACTTGAGGTTTTCTGG - Intergenic
1051770191 9:20569349-20569371 AGTAACCCATGGAGGCTTTCTGG - Intronic
1055370489 9:75593227-75593249 AGGAACCAATGGAGGTAGTCAGG - Intergenic
1055665638 9:78550091-78550113 AGCAGCCATTGGGGGTTTTAAGG + Intergenic
1055927339 9:81524084-81524106 AGCTACCTCTGGACTTTTTCTGG - Intergenic
1057811194 9:98257932-98257954 GGCCACCACTTGAGTTTTTCTGG - Intergenic
1058818350 9:108706120-108706142 AGAAGCCACTGCAGGTTTTGGGG + Intergenic
1060004233 9:119985563-119985585 AGGAGCCACTGGAGATTTTCAGG - Intergenic
1062183654 9:135204770-135204792 AGCCACCACTGCAGGCTTTAAGG - Intergenic
1062240171 9:135533267-135533289 AGCCAACACAGCAGGTTTTCTGG + Intergenic
1186052581 X:5614666-5614688 AGGAGCCGGTGGAGGTTTTCTGG - Intergenic
1187956260 X:24522015-24522037 AGCATCCACTTAAGGTGTTCAGG - Intronic
1194911343 X:99648712-99648734 AGCAACCACTGGGAGTTGACAGG + Intergenic
1196365600 X:114920351-114920373 AGCATGCACTGGAGTGTTTCAGG - Intergenic
1197064453 X:122221513-122221535 AGCACCCTGTTGAGGTTTTCAGG + Intergenic
1197361085 X:125504564-125504586 ATCAAACACTGGAGGTAGTCAGG - Intergenic
1197524934 X:127549164-127549186 AGCATCCCTTGGAGGTTCTCTGG + Intergenic
1197551763 X:127900652-127900674 AGCAACCTCTGGAGGATTTGGGG - Intergenic
1199095221 X:143730390-143730412 AGCAACCACTGGAGCTTGAGAGG + Intergenic
1199508835 X:148596977-148596999 AGTAACCCCTGGTGGTTGTCTGG - Intronic