ID: 1129098650

View in Genome Browser
Species Human (GRCh38)
Location 15:73236866-73236888
Sequence TGTGGGCTGCGGAGCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129098644_1129098650 -7 Left 1129098644 15:73236850-73236872 CCACACCCTTATGTGGTGTGGGC 0: 1
1: 0
2: 2
3: 9
4: 96
Right 1129098650 15:73236866-73236888 TGTGGGCTGCGGAGCTCCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129098650 Original CRISPR TGTGGGCTGCGGAGCTCCAG GGG Intronic
900090355 1:917619-917641 TGTGGGCTGGGGAGTGCCTGAGG + Intergenic
900156080 1:1203780-1203802 TGCGGCCTGGGGAGCTCCTGGGG + Exonic
900207674 1:1438569-1438591 TGTGGGGTGGGGTTCTCCAGAGG - Intronic
900337698 1:2172725-2172747 TGTTGTCTGGGGAGCCCCAGGGG + Intronic
900497153 1:2980930-2980952 TGGGGGCGGGGGGGCTCCAGCGG + Intergenic
905166986 1:36088632-36088654 TGTGGGCTGCAGTGATCCAATGG + Intergenic
905307661 1:37030631-37030653 TGTGTGTTGAGGAGCTCAAGTGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
907430611 1:54409133-54409155 TGTGGCCTGGGGGGATCCAGAGG - Intronic
907483121 1:54758318-54758340 TGTTGGCTGAGAAGCTGCAGCGG + Exonic
910057051 1:83045742-83045764 TGTTGGCTGCTGAGCTCTGGAGG - Intergenic
910200404 1:84692357-84692379 TGGGGGATGAGGAGCTTCAGGGG + Intergenic
912388391 1:109284282-109284304 TGAGGACTGAGGACCTCCAGAGG - Intergenic
915473946 1:156141465-156141487 TGTGGGCTGGGGAACACCAGGGG + Intergenic
915988632 1:160490974-160490996 TGAGAGATGCAGAGCTCCAGAGG + Intronic
916729587 1:167553870-167553892 TGCAGGTTGCGGAGCTGCAGAGG - Intergenic
920101992 1:203522465-203522487 TGGGGGCCGCGGAGCTCCAGAGG - Intergenic
923125560 1:231031607-231031629 TGTGGTCTGGGGACCTCTAGGGG - Intronic
924038276 1:239957750-239957772 TGGGGGCTGCAGAGATCCTGGGG + Intergenic
1068791941 10:61038645-61038667 TCTGGGCTGCTGGACTCCAGTGG + Intergenic
1068933663 10:62616180-62616202 GGTGGGCTGGGAAGCTTCAGAGG + Intronic
1069841713 10:71343916-71343938 TGTGGGCTGCACAGCACCAAGGG + Intronic
1070422201 10:76248057-76248079 TGTGGCCTGCAGAGATTCAGTGG + Intronic
1070795661 10:79214952-79214974 TGTGGGACGGGGCGCTCCAGGGG - Intronic
1071016213 10:80999806-80999828 TATGGACTACTGAGCTCCAGTGG - Intergenic
1071394887 10:85213329-85213351 TGTGTGCTGGACAGCTCCAGAGG + Intergenic
1071562529 10:86655271-86655293 TGTGGGCTTGGCAGATCCAGAGG - Intronic
1072074340 10:91954100-91954122 TGAGGGCTGAGGATCTCCAAAGG + Intronic
1072637095 10:97185358-97185380 TGTGGGCTGCGGAGCCCGGACGG + Intronic
1072790303 10:98312874-98312896 GGTGGACTGCGGAGGGCCAGAGG - Intergenic
1073242325 10:102066629-102066651 TGTGGGCTGGGAAGCCCCACAGG + Exonic
1074693831 10:116030126-116030148 TGGAGGCTGCAGAGATCCAGGGG - Intergenic
1074848182 10:117417297-117417319 TGTGGGCTGGGGGGCTCAAAGGG - Intergenic
1076017511 10:127039990-127040012 ATTGGGCTGCGGAGCTGCAGTGG - Intronic
1076439481 10:130471250-130471272 TGTGTGCTGGGAAGATCCAGTGG + Intergenic
1076762686 10:132613231-132613253 TGTGGGCCGTGGCGTTCCAGGGG - Intronic
1077424241 11:2466984-2467006 TGTGGGCAGCTGGGCTGCAGGGG + Intronic
1083282319 11:61634739-61634761 TGAGGGCTGCAGAGCCCCTGGGG + Intergenic
1084545749 11:69814275-69814297 TGTGGGCTGAAGAGATGCAGGGG + Intronic
1084657645 11:70528555-70528577 TGGGGGCAGCAGAGCTCCATGGG + Intronic
1084704171 11:70806305-70806327 TGTGGGCTGCGGAGGTTGTGTGG - Intronic
1093563392 12:20571424-20571446 TGTGCGCTGCACAACTCCAGGGG - Intronic
1094845437 12:34359428-34359450 TGTGGGCCGCGGGGCTCCATGGG + Intergenic
1094848328 12:34371197-34371219 CGTGGGCTGAGGTGCTCCATGGG + Intergenic
1096407976 12:51357628-51357650 AGTGAGCTGCAGAGCCCCAGAGG + Intronic
1096436021 12:51591475-51591497 AGTGCGCGGCGGGGCTCCAGGGG + Intronic
1101337688 12:103810845-103810867 TGTGGGTTCCTGAGGTCCAGAGG + Intronic
1102679885 12:114684206-114684228 TGTGGGCTGCGGGGAGCCGGAGG + Intergenic
1103074239 12:117969188-117969210 TAGGGGCTGCGGAGCTCGCGTGG + Intergenic
1104752308 12:131247556-131247578 CGTGGGGTGCAGAGCCCCAGGGG + Intergenic
1104779626 12:131411672-131411694 CGTGGGGTGCAGAGCCCCAGGGG - Intergenic
1104829210 12:131737125-131737147 GGTGGGCTGCAGAGCTCTGGGGG + Intronic
1107070820 13:36266532-36266554 TGAGAGTTGCAGAGCTCCAGAGG - Intronic
1108359926 13:49659666-49659688 TGTGGTCTGAGTAGCCCCAGTGG - Intergenic
1108569954 13:51739850-51739872 TGTGGGCTGAGGGTCACCAGTGG - Intronic
1111218763 13:85178411-85178433 TGTGCTCTGCAGAGCTACAGAGG - Intergenic
1113082696 13:106535090-106535112 GGCGCGCTGCGCAGCTCCAGCGG + Exonic
1113432764 13:110264834-110264856 TGTCAGCTCAGGAGCTCCAGTGG - Intronic
1113730584 13:112638498-112638520 GGTGGGAAGCGTAGCTCCAGGGG - Intergenic
1113786575 13:113005046-113005068 TGTGGGCTGGTGAGCTCTGGAGG - Intronic
1114014222 14:18411441-18411463 TGTGGGAAGCTGTGCTCCAGTGG - Intergenic
1114534959 14:23417019-23417041 TGAGGGCTGCTGAGGTCCAGTGG + Intronic
1115305632 14:31930867-31930889 TGTGGGCTCTGGAGCCCAAGAGG - Intergenic
1121610028 14:95272263-95272285 TGTGGGCTGAGGAGCTGGAAGGG + Intronic
1121632880 14:95433629-95433651 GCTGGGCTGCAGACCTCCAGTGG + Intronic
1122128360 14:99591270-99591292 AGAGGGCTGCACAGCTCCAGGGG - Intronic
1123938393 15:25205031-25205053 TGTGGCCTCCGGAGATCCTGTGG - Intergenic
1124002119 15:25768236-25768258 TGTGGGCTGGTGAGCGGCAGGGG + Intronic
1124340201 15:28885687-28885709 TGCTGGCTGGGGAGCTGCAGGGG - Intronic
1124846486 15:33296268-33296290 TGTGGCCTGAGGACCTCTAGGGG - Intergenic
1126909241 15:53400905-53400927 GATGGGCTGAGCAGCTCCAGAGG + Intergenic
1128145727 15:65331533-65331555 TGTGGGCTGAGGGGCTCCCCGGG - Exonic
1129098650 15:73236866-73236888 TGTGGGCTGCGGAGCTCCAGGGG + Intronic
1129325432 15:74798038-74798060 TGAGGGCTGAGGACCCCCAGGGG - Intronic
1129944408 15:79526651-79526673 TGTGTCCTGCGCTGCTCCAGTGG - Intergenic
1131110237 15:89760341-89760363 TGGGAGCTGCGGAGCCTCAGCGG - Intergenic
1131734095 15:95313728-95313750 TGAGGGCTGCAGAGTTTCAGGGG - Intergenic
1135154253 16:20038696-20038718 TGTGAGCTGAGGAGACCCAGAGG + Intronic
1136035465 16:27536565-27536587 TATTGACTGCGGATCTCCAGGGG - Intronic
1136736962 16:32474717-32474739 TGTGGCCTGAGGGGCTCCTGGGG + Intergenic
1137054339 16:35736109-35736131 TGTCGGCTGCGGACCCCCACGGG - Intergenic
1137393072 16:48097607-48097629 TGGGGAATGCGGAACTCCAGGGG - Intronic
1138267643 16:55671364-55671386 AGTGGGCAGGGGAGCTCCAGTGG + Intronic
1140535573 16:75706026-75706048 TGGGGGCTGCTGAGGGCCAGGGG - Intronic
1141915862 16:87096627-87096649 TGGGCGCTTCGGAGCCCCAGTGG + Intronic
1142049902 16:87951491-87951513 TGTGGGCTGCGGAATTCTCGTGG - Intronic
1203016109 16_KI270728v1_random:354860-354882 TGTGGCCTGAGGGGCTCCTGGGG - Intergenic
1203034444 16_KI270728v1_random:628018-628040 TGTGGCCTGAGGGGCTCCTGGGG - Intergenic
1144195452 17:12890407-12890429 TCTGGGCTGCTGCTCTCCAGAGG - Intronic
1144415466 17:15042336-15042358 CGTGTGCTGGGGAGTTCCAGGGG - Intergenic
1144789753 17:17850844-17850866 TGTGGGGTGTGGAGCGGCAGAGG - Intronic
1145266259 17:21380918-21380940 AGTGAGCTGTGGAGCACCAGTGG - Intronic
1145883311 17:28367047-28367069 TGGGGGCTGCTTAGCTCAAGAGG + Intronic
1147368814 17:39977227-39977249 AGTGGGTTGCGGAGCTGGAGGGG - Exonic
1147796877 17:43050232-43050254 TTTGTGCTGCGCAACTCCAGAGG + Intronic
1147996705 17:44363599-44363621 TGCGGGCTGGGGGGCTCCGGCGG + Exonic
1151958350 17:77392003-77392025 TGTGGGCTGCTGTGCCCCATAGG + Intronic
1152045186 17:77930693-77930715 TGGGGCCTGGGGAGCTGCAGGGG - Intergenic
1152701158 17:81820303-81820325 TGTGGGCTGTGGTGATCCAAAGG - Intergenic
1156194197 18:34754809-34754831 TGTGTGCTGTGGAGGTGCAGAGG + Intronic
1157386015 18:47260577-47260599 TGCGGGCTGCGGAGGTTCAGGGG + Intergenic
1157583484 18:48786920-48786942 GGTGGGGTGAGGAGCTCCAGAGG - Intronic
1158573010 18:58612649-58612671 TGTGCCCTGCAAAGCTCCAGTGG - Intronic
1158814697 18:61081111-61081133 TGTGGGTTGAGGAGCTCCCTGGG + Intergenic
1158899827 18:61952338-61952360 TGTGGGCTGCTTATCACCAGGGG + Intergenic
1160727731 19:625025-625047 TGGGGGCTGGGGACCCCCAGAGG - Intronic
1160735041 19:658550-658572 TGTGGGCCCCGCAGCCCCAGAGG + Intronic
1160839674 19:1140535-1140557 CGTGGGCTGCGGGGCTCCCGCGG - Intronic
1161269681 19:3382958-3382980 GGTGGGCTGTGGCGCTCCAATGG + Intronic
1163152716 19:15424626-15424648 TGAAGGCTGAGGAGCACCAGCGG - Exonic
1163723056 19:18907332-18907354 TGTGGGGTGGGGCGCTCCAAGGG + Intronic
1164527603 19:29023285-29023307 TGAGGCCTGCAGAGGTCCAGAGG + Intergenic
925302270 2:2825850-2825872 TGTGAGCAGCGGAGCTCTCGGGG - Intergenic
927194984 2:20540790-20540812 GGTGCCCTGGGGAGCTCCAGGGG + Intergenic
928313044 2:30226015-30226037 GGTGGGCTGCAGAGCCCCAGTGG + Intergenic
929670950 2:43876114-43876136 TGTGGGCTGAGGAGACTCAGCGG - Intronic
929750339 2:44705396-44705418 TGTGGGCTGCAGAGCTGCCCTGG + Intronic
930084834 2:47488940-47488962 TGTGGGCTGTGGCACTCCCGTGG + Intronic
934188105 2:89763838-89763860 TGTGGCCTGAGGGGCTCCTGGGG + Intergenic
934308501 2:91844116-91844138 TGTGGCCTGAGGGGCTCCTGGGG - Intergenic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
934762977 2:96866466-96866488 TGAGGGCTGTCGAGCCCCAGGGG - Intronic
934795879 2:97098555-97098577 TGTGTTCTGCACAGCTCCAGGGG - Intergenic
935947909 2:108302555-108302577 TGTGGGATGGTGAGCTCAAGTGG - Intronic
938406765 2:131037125-131037147 CGGGGGCTGCAGACCTCCAGAGG - Intronic
939460145 2:142488535-142488557 TGTGACCCCCGGAGCTCCAGAGG - Intergenic
943811547 2:192194904-192194926 TGCGGGCGGCAGAGCTCGAGAGG - Exonic
943964831 2:194320046-194320068 GGTGTGCTGCAGTGCTCCAGTGG + Intergenic
946332301 2:219017362-219017384 AGTGGGAGGGGGAGCTCCAGGGG - Intronic
947397037 2:229696573-229696595 TGTGGTCTGCTGAGCTCCTTTGG - Intronic
947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG + Exonic
947869006 2:233422079-233422101 AGTGGGCTGTGGGGCTGCAGAGG + Intronic
948935006 2:241158149-241158171 TGTGGGCTCAGGAGGCCCAGTGG - Intronic
1170572071 20:17638085-17638107 TGTGGGCTGGGAAGCCCCTGGGG + Intronic
1172623947 20:36336871-36336893 TGGGGTCTGCTGGGCTCCAGTGG - Intronic
1172656723 20:36542302-36542324 TCTGGCCTGCCCAGCTCCAGGGG + Intronic
1174634666 20:51988700-51988722 TGAGGTCTGCAGAACTCCAGGGG + Intergenic
1175187933 20:57191278-57191300 TGTGCTCTGGGGTGCTCCAGAGG + Intronic
1175749129 20:61483103-61483125 TCTGGGCTCAGCAGCTCCAGGGG - Intronic
1175927026 20:62476007-62476029 AGGGGGCTGCGGAGCCTCAGCGG - Intergenic
1176077061 20:63253520-63253542 TGTGGGCTGCGGAGCGCAGCTGG - Intronic
1176115771 20:63431242-63431264 GGTGGGCCACGGGGCTCCAGGGG + Intronic
1178771460 21:35508619-35508641 TGTGCACTGCACAGCTCCAGGGG - Intronic
1178948471 21:36966846-36966868 TGTGTGATGGGGAGCTCCGGAGG + Intronic
1180438719 22:15342247-15342269 TGTGGGAAGCTGTGCTCCAGTGG - Intergenic
1180535588 22:16391195-16391217 TGTGGCCTGAGGGGCTCCTGGGG - Intergenic
1180706565 22:17813839-17813861 GGTGGGCTGCAGGGCTCAAGAGG + Intronic
1181023158 22:20113857-20113879 TGTGGGCGTCGGGGCACCAGTGG - Intronic
1181278699 22:21703450-21703472 CGTGGGCTGCGGCCCTGCAGAGG - Exonic
1182222996 22:28773164-28773186 ACTGGGCTGCGAAGCTCCCGCGG - Intronic
1182295750 22:29310587-29310609 GGTGGGCTGCGGGGCGCCCGGGG + Intronic
1183459368 22:37940697-37940719 TCTGTGCTGCAGAGTTCCAGAGG + Exonic
1184233845 22:43172598-43172620 TGTGTGCTCGGGAGCCCCAGGGG - Intronic
1185032215 22:48450133-48450155 ACTGGGCTGGGGAGCTCCGGTGG + Intergenic
950503047 3:13376544-13376566 TGGAGGCTGCTGAGCCCCAGGGG - Intronic
953025520 3:39142740-39142762 AGTGGTCTGCCAAGCTCCAGAGG + Exonic
954322691 3:49842832-49842854 TGTGGGCTGCCAAGGTCCAGTGG + Intronic
955480677 3:59386052-59386074 TGTGGCCTATGTAGCTCCAGGGG + Intergenic
956013053 3:64852122-64852144 TGTGTACTGCTAAGCTCCAGGGG - Intergenic
956049327 3:65230712-65230734 AGTGGGCCGGGGAGCTCCATGGG + Intergenic
961053459 3:123766933-123766955 TGGGGGCTGGGGAGCACCAAAGG + Intronic
961819239 3:129566788-129566810 TGGGGGCTGTGGAATTCCAGGGG + Intronic
962212442 3:133490664-133490686 TGTGGGCTCCTCAGCACCAGAGG - Intergenic
964171818 3:153779677-153779699 TGTGGGCTGCTGAGCACTTGTGG - Intergenic
968230717 3:197003228-197003250 CGTGGGCGGCGGGGCTCCCGGGG + Exonic
969719963 4:8888204-8888226 TGTGGGGTGCGGAGGTGGAGGGG - Intergenic
982468495 4:155759451-155759473 TGTGGGAGGCTGAGCGCCAGCGG + Intronic
985868490 5:2535204-2535226 TGTGGGCTTCAGAGACCCAGGGG + Intergenic
986457936 5:7939169-7939191 TACGGGCTCCAGAGCTCCAGAGG - Intergenic
987862618 5:23506810-23506832 TCTGGGCTGCGGGGCTCCCTCGG - Intergenic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992563631 5:77976304-77976326 TTTGCCCTGCGGAGCTCCTGAGG + Intergenic
995869650 5:116730985-116731007 TGTGGTTTGCGGATCTCCAAAGG - Intergenic
996417193 5:123223038-123223060 GGTGGGCAGAGGAGCTGCAGAGG - Intergenic
1001933551 5:175689257-175689279 TGTGGGCTGAGGGGGGCCAGAGG - Intergenic
1005200879 6:23342751-23342773 TGGGGACAGCTGAGCTCCAGGGG + Intergenic
1005939966 6:30553364-30553386 TGTGGGGTGCGGGGGTCCCGAGG + Exonic
1006783804 6:36651149-36651171 TCTGGGCTGGGGAGCCCCGGGGG + Intergenic
1007335745 6:41153914-41153936 TGTGGATCGCAGAGCTCCAGCGG - Exonic
1011093968 6:83637632-83637654 TGTGGGCTGCAGGGCTCCCTGGG + Intronic
1016533985 6:145090618-145090640 AGTGGGATGGGGAGCTACAGAGG + Intergenic
1019274297 7:167653-167675 TGAGGGCTGCGGTGGCCCAGCGG + Intergenic
1019644854 7:2123617-2123639 TGAGGGCTGCTGCCCTCCAGCGG - Intronic
1019995600 7:4722480-4722502 AGTGGGCTGCTCAGCACCAGTGG + Intronic
1022330211 7:29371663-29371685 GGTGGCCTGAGGAGGTCCAGTGG - Intronic
1024059896 7:45689977-45689999 TGTGGGCAGTGGAGCTGCAAAGG + Intronic
1026775675 7:73229719-73229741 TGTGGGTTCCTGAGCACCAGGGG - Intergenic
1027016533 7:74783091-74783113 TGTGGGTTCCTGAGCACCAGGGG - Intronic
1027071495 7:75162845-75162867 TGTGGGTTCCTGAGCACCAGGGG + Intergenic
1028758550 7:94466935-94466957 TTTGGGCTCATGAGCTCCAGGGG - Intergenic
1032075481 7:128833872-128833894 GGTGGGCTGGGGAGCTGCTGGGG + Intronic
1033216212 7:139495482-139495504 TGTGGGCTGCTTAGCCCCAGCGG - Intergenic
1035258042 7:157644430-157644452 TGAGGTCTGTGGACCTCCAGGGG - Intronic
1037567812 8:20132270-20132292 TTTGGGCTGCGGAGATCCCTGGG - Intergenic
1037721339 8:21446966-21446988 TGTGGGCTGCAAAGCAGCAGAGG - Intergenic
1038207605 8:25482085-25482107 TGTCTCCTGCTGAGCTCCAGGGG + Intronic
1038246486 8:25861127-25861149 TGTGCGCTGGGGAGCTAGAGAGG + Exonic
1039153630 8:34530979-34531001 TGTGTGCTGGAGAGCTCCTGTGG - Intergenic
1039997679 8:42548051-42548073 TGTTGGCTGCTGAACTCTAGGGG + Intronic
1041858200 8:62481932-62481954 TGTGGGCTGGTGAGCTACTGTGG - Intronic
1042021868 8:64377792-64377814 TCTGGGCTGCGGAAGTCCAGAGG - Intergenic
1045607759 8:103796846-103796868 TGTGTGCAGCAGAACTCCAGGGG + Intronic
1045989640 8:108290751-108290773 TGTGGGATGTGGTGCTCAAGTGG - Intronic
1048351263 8:133618622-133618644 TGTGAGATGTGGAACTCCAGAGG + Intergenic
1049340250 8:142108607-142108629 TGTGGACTGAGGTCCTCCAGGGG - Intergenic
1052048973 9:23824344-23824366 CGTCCGCCGCGGAGCTCCAGTGG + Intronic
1056225769 9:84493694-84493716 TGAGGGCTGGAGTGCTCCAGGGG + Intergenic
1056275340 9:84989158-84989180 TGTGAGCTGTGCAGGTCCAGTGG - Intronic
1057161442 9:92891261-92891283 TGTAGGCAGCATAGCTCCAGAGG - Intergenic
1058306022 9:103441559-103441581 TGTGGTCTGTGGACCCCCAGGGG - Intergenic
1060547394 9:124469355-124469377 TGTGAGCTGGGGACCTGCAGGGG + Exonic
1060809701 9:126604470-126604492 TGTGGGCTGGGCAGCCTCAGAGG - Intergenic
1061579744 9:131529749-131529771 TGTGGTCTGCAGGGCTGCAGAGG - Intronic
1061743107 9:132721859-132721881 GGTGGGGTGAGCAGCTCCAGGGG + Intergenic
1062009539 9:134259529-134259551 TGTGGGCTGCTGAGCTGCTGAGG + Intergenic
1062040672 9:134402926-134402948 TGTGGGCAGAGGAGCTCCTAGGG - Intronic
1062245770 9:135565344-135565366 TGAGAGCTGGGGAGCTCCAGAGG - Intronic
1062366243 9:136210492-136210514 TGTGGGCGGCGGCGATGCAGAGG + Intronic
1062530675 9:136998207-136998229 TGTGGACTGTGGAGCGGCAGTGG + Intergenic
1186157496 X:6740763-6740785 TGTGGGATGAGGAGCACGAGAGG - Intergenic
1189239903 X:39517014-39517036 AGTGGGCTGTGGGGCTCCACAGG + Intergenic
1192806236 X:74511986-74512008 GGTCAGCTGGGGAGCTCCAGAGG - Intronic
1196614327 X:117750425-117750447 TGTGGGCTGTGGGGCTTCTGAGG - Intergenic
1199016237 X:142819525-142819547 TGTGCACTGGGCAGCTCCAGTGG + Intergenic