ID: 1129100925

View in Genome Browser
Species Human (GRCh38)
Location 15:73262984-73263006
Sequence TAGTGACAAAGCAAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129100925 Original CRISPR TAGTGACAAAGCAAGATCAG TGG Intronic
904230897 1:29070699-29070721 TAGTGAACTATCAAGATCAGAGG - Intronic
906544837 1:46613577-46613599 AAGAGACAAAGCAAGATGGGAGG - Intronic
908304942 1:62803262-62803284 TAGTGACTAATCAATATAAGTGG + Intronic
916919176 1:169444691-169444713 TAGTGACAATCCAAAAGCAGTGG + Intronic
918598688 1:186325628-186325650 CAGTCACAAAGCTAGAACAGGGG + Intronic
919413325 1:197274616-197274638 TAGAGACATAGAATGATCAGTGG - Intronic
919496066 1:198269803-198269825 TAGTGACAAAGGAATACCTGAGG + Intronic
924159591 1:241217172-241217194 GAGAGAGAAAGCAAGCTCAGTGG - Intronic
1065381776 10:25097863-25097885 TAATGACAATGGAAGATCTGGGG - Intergenic
1070707359 10:78650067-78650089 TAGTGGCAAAGAAATATCAAGGG + Intergenic
1071238161 10:83673649-83673671 AAGTGTTAAAGCAAGTTCAGTGG - Intergenic
1071454407 10:85833354-85833376 GAATCACAAAGAAAGATCAGAGG + Intronic
1072177364 10:92941112-92941134 TAGAGACAAAGCAAGAGTGGTGG - Intronic
1073319827 10:102608453-102608475 TAGTGCCAAGGCAAGCCCAGGGG + Intronic
1073703518 10:105956847-105956869 TAGTGAACATGCAAGAGCAGTGG - Intergenic
1073738166 10:106374171-106374193 TAGTGTTGAAACAAGATCAGTGG + Intergenic
1074058029 10:109940434-109940456 CAGTGACAAAGCAGGTTCAAAGG + Intergenic
1076691552 10:132226123-132226145 TTGGGACAAAGCAAGAGCCGAGG - Intronic
1080456416 11:32423595-32423617 TAGAGAGAAAGCAAGTGCAGAGG + Intronic
1083613473 11:64015292-64015314 GAGAGACAAAGGCAGATCAGTGG + Intronic
1084926793 11:72520241-72520263 TAGTGAAAATACAAAATCAGCGG + Intergenic
1086364769 11:86097629-86097651 AAATGTCAAAGCAAGAACAGAGG - Intergenic
1086415274 11:86582979-86583001 TGGTGAGAAACCAAGATCAGAGG + Intronic
1089855145 11:121537083-121537105 AAGGGCCAAAGCATGATCAGTGG + Intronic
1090686999 11:129132453-129132475 GAGCAACAGAGCAAGATCAGGGG + Intronic
1092714040 12:11369740-11369762 TAGTGGGAAAGGAAGATCCGAGG + Intronic
1092717749 12:11408773-11408795 TAGTGGGAAAGGAAGATCCGAGG + Intronic
1093001147 12:13997798-13997820 CAGTAACAAAGCAAAATCAATGG + Intergenic
1093143451 12:15537029-15537051 TAGAGACACAGCAAGATTTGCGG + Intronic
1093491242 12:19707155-19707177 TAGAGACAAAACTAGATTAGTGG - Intronic
1093795950 12:23310883-23310905 TACAGACAAAGAAAGATCAGAGG + Intergenic
1095402470 12:41830803-41830825 GGGTGACAAAGCAAGACCAGAGG + Intergenic
1100932704 12:99628766-99628788 TGGTGAGAGAGCAAGAGCAGAGG + Intronic
1105248266 13:18672592-18672614 TAGTGCAAAAGCAACATGAGAGG + Intergenic
1105664028 13:22532194-22532216 TAGAGACAAACAAAGATAAGAGG + Intergenic
1106540568 13:30686571-30686593 TAGTGACAAAGGAAGGGAAGAGG - Intergenic
1106938331 13:34748399-34748421 TGGTGACAAAGCTAGACAAGGGG - Intergenic
1107209434 13:37835637-37835659 CAGTGACAAAGAAAGATAAAAGG + Intronic
1109733641 13:66451818-66451840 TAGTGAAAAAGGAATATCACAGG - Intronic
1110178724 13:72589629-72589651 TAGTGAGAAAGAAAGTACAGAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111877867 13:93919130-93919152 TCATGACAAGGCAAGAGCAGGGG - Intronic
1114157266 14:20118786-20118808 TGGGGACAGAGCAAGATCACAGG + Intergenic
1114491094 14:23102440-23102462 TAGTGACAAGGCAAGATGAGTGG - Intergenic
1114699089 14:24658854-24658876 TAGTGACAAAGGAAGAGCTGTGG + Intergenic
1115248327 14:31319483-31319505 TAGGGACAAAGCAAAATGAAGGG - Intronic
1115885011 14:37961590-37961612 TAGTGAGAATGCAAGAGTAGAGG + Intronic
1116100517 14:40427903-40427925 TATTGACAAAGTAAGATGAAAGG - Intergenic
1118237301 14:64019370-64019392 TAGAGACAAAACGAGATCTGAGG - Intronic
1118743334 14:68756871-68756893 AAATGACACATCAAGATCAGTGG + Intergenic
1119630946 14:76231515-76231537 TAGTGACAGAGCCAGATTTGAGG + Intronic
1120838835 14:89064976-89064998 TAGGGACAAAGCAGGGTCAAGGG + Intergenic
1122042706 14:99000275-99000297 TAATTAGAAAACAAGATCAGAGG + Intergenic
1122491508 14:102119152-102119174 AAGTAAAAAAGCAAGAACAGAGG - Intronic
1124040967 15:26103304-26103326 TAGTCACAAAGCAAGACCAAGGG + Intergenic
1129100925 15:73262984-73263006 TAGTGACAAAGCAAGATCAGTGG + Intronic
1132133045 15:99302747-99302769 GAGACAAAAAGCAAGATCAGTGG - Intronic
1133446503 16:5865594-5865616 TGGTGCCAAAGCCAGGTCAGTGG + Intergenic
1134060199 16:11194947-11194969 TCGTGCCAAAGCAAGCTCAAGGG + Intergenic
1137493253 16:48950600-48950622 TAGGGCCACAGAAAGATCAGTGG - Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1140774754 16:78239496-78239518 TAATGCCTAAGCAAGAACAGAGG - Intronic
1146260790 17:31418974-31418996 TAGTGACAAAGCCAGATCAGTGG - Intronic
1147957224 17:44142650-44142672 GAGTGTCAAACCCAGATCAGAGG - Intronic
1149450684 17:56747833-56747855 TAGTGAAAAAGAAATATGAGAGG - Intergenic
1149980140 17:61304248-61304270 TAGTGACATGGCCAGAGCAGTGG - Intronic
1151392943 17:73800066-73800088 CAGTGAAAAAAAAAGATCAGTGG + Intergenic
1155403144 18:25460348-25460370 TAGGGACAAAGCCACATCAGAGG + Intergenic
1156522513 18:37733747-37733769 TTGTGGCAAAGCCAGATTAGCGG - Intergenic
1156553509 18:38042584-38042606 TACTGAGAAAGCAACTTCAGGGG + Intergenic
1157005813 18:43582802-43582824 TAGTGACAGAAACAGATCAGTGG + Intergenic
1158585712 18:58732190-58732212 TATTGAGAGAGCAAAATCAGTGG + Intronic
1162269607 19:9603602-9603624 AGGTGATAAAGCAAGATGAGAGG + Intergenic
1163770256 19:19186794-19186816 TGGTGGCAAAGCCAGGTCAGAGG - Intronic
1164925167 19:32124657-32124679 TTTTGACAAAGGAAAATCAGTGG - Intergenic
925238499 2:2299858-2299880 TAGTGCCAAAGTAAGATTTGGGG - Intronic
926016385 2:9455483-9455505 TAGGGACATAGGGAGATCAGTGG + Intronic
927646788 2:24882474-24882496 TAGTGAAGCAGCAAGAGCAGTGG - Intronic
931505563 2:62922687-62922709 GAGTGTCAAAGAAAGAGCAGTGG + Intronic
931611349 2:64104483-64104505 AAATGACAAACCAGGATCAGTGG - Intronic
938951312 2:136257140-136257162 AAGTGAAAACGCAGGATCAGAGG - Intergenic
939417416 2:141917379-141917401 TATTGATAAAGCAAAATCAAAGG - Intronic
941183042 2:162284530-162284552 CAGTGGCAAAGGAAGACCAGTGG + Intronic
941687958 2:168467060-168467082 AAGTGACAAAGGAAGAAGAGAGG - Intronic
942017799 2:171834317-171834339 AAGTGAATAAGCAAGATAAGAGG - Intronic
943682600 2:190783952-190783974 ATGTGACATAGGAAGATCAGTGG - Intergenic
948012599 2:234661911-234661933 GAGTGAGATAGCAAGTTCAGAGG + Intergenic
948155083 2:235775052-235775074 TAGTGACAAAGCAAAAGGACTGG + Intronic
948360101 2:237413781-237413803 AAGTGAGAAAGAAAAATCAGCGG + Intronic
1169894771 20:10491109-10491131 AAGTGACAAAGCAAGACAAGAGG - Intronic
1170198369 20:13714940-13714962 CATTGACAAAGCAGGATCAATGG + Exonic
1170461402 20:16580071-16580093 TAATTACAAAGCAAGCACAGGGG - Intergenic
1172384952 20:34527642-34527664 TAGAGCCAAAGCAAGACCTGAGG + Intronic
1174373190 20:50107988-50108010 TGGGGACAGAGCAAGATCAGAGG + Intronic
1176455457 21:6904654-6904676 TAGTGCAAAAGCAACATGAGTGG + Intergenic
1176833629 21:13769702-13769724 TAGTGCAAAAGCAACATGAGTGG + Intergenic
1177657061 21:24031338-24031360 AAGGGACTAAGCAAGATCATTGG + Intergenic
1180003575 21:45007649-45007671 TAGTGACAGAAACAGATCAGTGG - Intergenic
1181363910 22:22358905-22358927 TAGTGACAGAGACAGATCTGTGG - Intergenic
1181907103 22:26207231-26207253 TGGTGTCAAAGCAAGATGAATGG - Intronic
951919725 3:27841035-27841057 GAGTGACAAGGCAGGATTAGTGG + Intergenic
953056545 3:39392023-39392045 TAGGGATAAAGGAAGATCTGGGG + Intronic
954516513 3:51182520-51182542 TAGAGGCAAAGAAAGACCAGTGG - Intronic
954980986 3:54745137-54745159 AAGTGCCAAGGCAAGATGAGTGG + Intronic
956318579 3:67968734-67968756 TAGTGACAAAACAACAGCAAGGG + Intergenic
958254045 3:91303921-91303943 TAGTGAGAAAGAAAGAAAAGTGG + Intergenic
959952837 3:112200026-112200048 TAGTTACCAAGCCAGATAAGAGG - Intronic
961959909 3:130844154-130844176 TAGTGAGAAAAAAAAATCAGGGG + Intergenic
962039385 3:131689236-131689258 TAGTGACAAAGAAGAATTAGAGG + Intronic
963908309 3:150792473-150792495 TTGTGAGAAGGCAAGATCAGGGG - Intergenic
974141513 4:57894304-57894326 TAGTCACAAAGCAAAACCTGGGG - Intergenic
974618541 4:64323839-64323861 TACAGAAAAAGCAAGATCTGAGG + Intronic
974704757 4:65498463-65498485 GGGTAAAAAAGCAAGATCAGAGG + Intronic
975931508 4:79529434-79529456 TAGTGACAAATACAAATCAGAGG - Intergenic
976354080 4:84095238-84095260 CAGTGACAACGGTAGATCAGTGG + Intergenic
977011520 4:91640324-91640346 TACTGACAAAGATAGATCATAGG + Intergenic
978076268 4:104533988-104534010 AAGCGAGAAAGCGAGATCAGTGG - Intergenic
980953151 4:139401408-139401430 TAGGGACAAAGCAAGGTGAAGGG + Intronic
984226742 4:177044405-177044427 TAGTGAGAAAGAAAGGACAGGGG - Intergenic
985287341 4:188349692-188349714 TAAAGACAAAGCAAGAGAAGGGG - Intergenic
985939846 5:3126768-3126790 GAGTGACGAAGCCAGATCATGGG + Intergenic
987670572 5:21002045-21002067 TAGTGAAAAAAAAAGGTCAGAGG - Intergenic
989266579 5:39481539-39481561 TAGGGAGAAAGAAAGCTCAGAGG + Intergenic
989795314 5:45463614-45463636 CAGTGACCAAGAAATATCAGAGG - Intronic
992325205 5:75653784-75653806 TAATGGCTCAGCAAGATCAGAGG - Intronic
993168496 5:84385249-84385271 TACTGAGAAAGGAAGTTCAGGGG - Intergenic
993233380 5:85269390-85269412 TGGTGTCAAAGAAAAATCAGAGG + Intergenic
993419221 5:87679778-87679800 TAGTGACAGAAGCAGATCAGTGG + Intergenic
994225691 5:97249640-97249662 TAGTGTGAAAGCAAGAGGAGTGG - Intergenic
994234001 5:97340209-97340231 TAGGGAGAAAGCAAGAGGAGAGG + Intergenic
997794187 5:136791606-136791628 TAGTGACAGAGGAACATGAGGGG + Intergenic
999447684 5:151653458-151653480 TACAGACAAAAAAAGATCAGAGG - Intergenic
1000087690 5:157902426-157902448 TAGTGGCAAAGCCAGGACAGGGG - Intergenic
1000219335 5:159197767-159197789 TAATTAAAAAGCAAGACCAGTGG + Intronic
1000293723 5:159894710-159894732 TAGGGATAGAGCAACATCAGGGG + Intergenic
1000595213 5:163207761-163207783 TAGTGAGAAAACAAGTTCAATGG + Intergenic
1003482001 6:6543041-6543063 TAGTTACTAGGCAAGAACAGGGG - Intergenic
1005417722 6:25619396-25619418 TACTGACAAAGTAATACCAGTGG - Intronic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1008564138 6:52750841-52750863 CAGTGAGAAAGGAAGATAAGAGG + Intronic
1009507878 6:64507922-64507944 AAGTGACAAAGCAATACCAAGGG + Intronic
1010340292 6:74742672-74742694 TAGTGACAAAACATGATAAGTGG - Intergenic
1010577713 6:77553268-77553290 AAGTGAGAAAGGAATATCAGTGG - Intergenic
1012215345 6:96576032-96576054 TAGTGACTTAGCATGAGCAGGGG - Intronic
1013502703 6:110768680-110768702 TAGAGACAGAAAAAGATCAGTGG + Intronic
1014527801 6:122521761-122521783 AAGTGAAAAAGCTAGATAAGTGG - Intronic
1015014891 6:128400320-128400342 TAGAGGAAAAGCAAGATCAAAGG + Intronic
1015783894 6:136900835-136900857 CAGAGACAAAGCAAGAGAAGAGG - Intronic
1018277631 6:162149848-162149870 TACTGATGAAGCAAGAACAGGGG + Intronic
1023389168 7:39691454-39691476 TAGTGACAAAGTAGGAACATGGG + Intronic
1023861142 7:44218310-44218332 TAGTGGCAGAGCGGGATCAGAGG - Exonic
1024644042 7:51356483-51356505 TGGAGACAAAGCCAGAGCAGGGG - Intergenic
1029973280 7:104810332-104810354 AATTGAAAAAGCAAGATTAGAGG + Intronic
1030637983 7:111971677-111971699 CAGAGACAAAGCAAGAGAAGAGG - Intronic
1032365279 7:131293031-131293053 AAGTGACAAAGCCAGCCCAGAGG - Intronic
1032595633 7:133236783-133236805 TTGTGCCAGAGCAAGAACAGAGG - Intergenic
1032799039 7:135303390-135303412 TAGTGACAAAGAAGGAAGAGGGG + Intergenic
1033325271 7:140372432-140372454 CACTGACAATGCAAGAGCAGTGG + Intronic
1033904942 7:146191391-146191413 TGGGGACAGAGCGAGATCAGAGG + Intronic
1033920378 7:146384303-146384325 TATTGACATATGAAGATCAGTGG + Intronic
1035626270 8:1073025-1073047 TTGTGACAACATAAGATCAGAGG - Intergenic
1037021068 8:13971262-13971284 GAGAGACAAAGGAAAATCAGTGG + Intergenic
1037067801 8:14603916-14603938 TAGTTTGAAAACAAGATCAGCGG - Intronic
1037340328 8:17838114-17838136 TAGTGGCAAACCAAGATGATAGG - Intergenic
1038114379 8:24536644-24536666 TGGTGACCAAGCAAGTTCACAGG + Intergenic
1039459602 8:37732546-37732568 GAGTGGCAAAAGAAGATCAGTGG + Intergenic
1041054862 8:53974126-53974148 CATTGACAAGGCAGGATCAGTGG - Intronic
1043922997 8:86005217-86005239 TGGTGAAAGAGCTAGATCAGTGG + Intronic
1045375454 8:101569116-101569138 TAGTGAAAAAACAAGATACGTGG + Intronic
1046677832 8:117131608-117131630 TATTGAAAAAGGAAGATCTGGGG - Intronic
1047308576 8:123673451-123673473 TACTGAAAAAGCAAAATGAGAGG + Intergenic
1048015820 8:130496815-130496837 TAGTGACAGAGGCAAATCAGTGG + Intergenic
1049666764 8:143847805-143847827 TAGCAACAAAGCAAGACCAGAGG - Intergenic
1050664606 9:7921324-7921346 TAGGGACTAAACTAGATCAGTGG - Intergenic
1061314898 9:129788973-129788995 TAGTGACAGAACGAGATCGGTGG + Intergenic
1186240175 X:7557104-7557126 TAGTGACAAGGAAAATTCAGCGG - Intergenic
1188840773 X:35014345-35014367 GAGTGAGAAAGCAAGAGCAATGG - Intergenic
1189822669 X:44885500-44885522 TACTGCCAAAGCAAGCACAGAGG - Intronic
1189915166 X:45849831-45849853 TTGACACAAAGAAAGATCAGGGG + Intergenic
1192927969 X:75776510-75776532 CACTGACAAAGCAATGTCAGGGG + Intergenic
1195945873 X:110210848-110210870 TAGGGACAGAGTGAGATCAGGGG + Intronic
1196960364 X:120993855-120993877 TGGTGACAAAGAAAGCTGAGTGG - Intergenic
1199596358 X:149509326-149509348 TAGTGTCACAGGAAGCTCAGGGG + Intronic