ID: 1129106234

View in Genome Browser
Species Human (GRCh38)
Location 15:73309237-73309259
Sequence GCACTGAATGCAGTGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106234_1129106247 27 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106234_1129106243 13 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106243 15:73309273-73309295 GGCCAGTGCAAAGGCTATGGAGG No data
1129106234_1129106238 4 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106238 15:73309264-73309286 GCCCCAGCAGGCCAGTGCAAAGG No data
1129106234_1129106244 14 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106244 15:73309274-73309296 GCCAGTGCAAAGGCTATGGAGGG No data
1129106234_1129106242 10 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106242 15:73309270-73309292 GCAGGCCAGTGCAAAGGCTATGG No data
1129106234_1129106246 22 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106234_1129106237 -8 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106237 15:73309252-73309274 TTCAGTGCAGAGGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106234 Original CRISPR GCACTGAATGCAGTGACAGG AGG (reversed) Intergenic
No off target data available for this crispr