ID: 1129106239

View in Genome Browser
Species Human (GRCh38)
Location 15:73309265-73309287
Sequence GCCTTTGCACTGGCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106239_1129106248 7 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106248 15:73309295-73309317 GGTGCACAGGTCTGGCTAGCTGG No data
1129106239_1129106253 24 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106239_1129106250 15 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106250 15:73309303-73309325 GGTCTGGCTAGCTGGCTTTCGGG No data
1129106239_1129106254 30 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data
1129106239_1129106247 -1 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106239_1129106249 14 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106249 15:73309302-73309324 AGGTCTGGCTAGCTGGCTTTCGG No data
1129106239_1129106251 16 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106251 15:73309304-73309326 GTCTGGCTAGCTGGCTTTCGGGG No data
1129106239_1129106246 -6 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106239_1129106252 23 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106252 15:73309311-73309333 TAGCTGGCTTTCGGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106239 Original CRISPR GCCTTTGCACTGGCCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr