ID: 1129106241

View in Genome Browser
Species Human (GRCh38)
Location 15:73309267-73309289
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106241_1129106246 -8 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106241_1129106249 12 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106249 15:73309302-73309324 AGGTCTGGCTAGCTGGCTTTCGG No data
1129106241_1129106253 22 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106241_1129106252 21 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106252 15:73309311-73309333 TAGCTGGCTTTCGGGGAGAGAGG No data
1129106241_1129106247 -3 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106241_1129106251 14 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106251 15:73309304-73309326 GTCTGGCTAGCTGGCTTTCGGGG No data
1129106241_1129106250 13 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106250 15:73309303-73309325 GGTCTGGCTAGCTGGCTTTCGGG No data
1129106241_1129106248 5 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106248 15:73309295-73309317 GGTGCACAGGTCTGGCTAGCTGG No data
1129106241_1129106254 28 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106241 Original CRISPR TAGCCTTTGCACTGGCCTGC TGG (reversed) Intergenic