ID: 1129106245

View in Genome Browser
Species Human (GRCh38)
Location 15:73309275-73309297
Sequence ACCCTCCATAGCCTTTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106245_1129106253 14 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106245_1129106251 6 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106251 15:73309304-73309326 GTCTGGCTAGCTGGCTTTCGGGG No data
1129106245_1129106248 -3 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106248 15:73309295-73309317 GGTGCACAGGTCTGGCTAGCTGG No data
1129106245_1129106249 4 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106249 15:73309302-73309324 AGGTCTGGCTAGCTGGCTTTCGG No data
1129106245_1129106254 20 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data
1129106245_1129106250 5 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106250 15:73309303-73309325 GGTCTGGCTAGCTGGCTTTCGGG No data
1129106245_1129106252 13 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106252 15:73309311-73309333 TAGCTGGCTTTCGGGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106245 Original CRISPR ACCCTCCATAGCCTTTGCAC TGG (reversed) Intergenic