ID: 1129106246

View in Genome Browser
Species Human (GRCh38)
Location 15:73309282-73309304
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106235_1129106246 19 Left 1129106235 15:73309240-73309262 CCTGTCACTGCATTCAGTGCAGA No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106234_1129106246 22 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106240_1129106246 -7 Left 1129106240 15:73309266-73309288 CCCAGCAGGCCAGTGCAAAGGCT No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106241_1129106246 -8 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data
1129106239_1129106246 -6 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106246 15:73309282-73309304 AAAGGCTATGGAGGGTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106246 Original CRISPR AAAGGCTATGGAGGGTGCAC AGG Intergenic