ID: 1129106247

View in Genome Browser
Species Human (GRCh38)
Location 15:73309287-73309309
Sequence CTATGGAGGGTGCACAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106241_1129106247 -3 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106240_1129106247 -2 Left 1129106240 15:73309266-73309288 CCCAGCAGGCCAGTGCAAAGGCT No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106234_1129106247 27 Left 1129106234 15:73309237-73309259 CCTCCTGTCACTGCATTCAGTGC No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106239_1129106247 -1 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data
1129106235_1129106247 24 Left 1129106235 15:73309240-73309262 CCTGTCACTGCATTCAGTGCAGA No data
Right 1129106247 15:73309287-73309309 CTATGGAGGGTGCACAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106247 Original CRISPR CTATGGAGGGTGCACAGGTC TGG Intergenic