ID: 1129106253

View in Genome Browser
Species Human (GRCh38)
Location 15:73309312-73309334
Sequence AGCTGGCTTTCGGGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106245_1129106253 14 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106241_1129106253 22 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106239_1129106253 24 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data
1129106240_1129106253 23 Left 1129106240 15:73309266-73309288 CCCAGCAGGCCAGTGCAAAGGCT No data
Right 1129106253 15:73309312-73309334 AGCTGGCTTTCGGGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106253 Original CRISPR AGCTGGCTTTCGGGGAGAGA GGG Intergenic
No off target data available for this crispr