ID: 1129106254

View in Genome Browser
Species Human (GRCh38)
Location 15:73309318-73309340
Sequence CTTTCGGGGAGAGAGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106240_1129106254 29 Left 1129106240 15:73309266-73309288 CCCAGCAGGCCAGTGCAAAGGCT No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data
1129106245_1129106254 20 Left 1129106245 15:73309275-73309297 CCAGTGCAAAGGCTATGGAGGGT No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data
1129106241_1129106254 28 Left 1129106241 15:73309267-73309289 CCAGCAGGCCAGTGCAAAGGCTA No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data
1129106239_1129106254 30 Left 1129106239 15:73309265-73309287 CCCCAGCAGGCCAGTGCAAAGGC No data
Right 1129106254 15:73309318-73309340 CTTTCGGGGAGAGAGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106254 Original CRISPR CTTTCGGGGAGAGAGGGAGC TGG Intergenic
No off target data available for this crispr