ID: 1129106256

View in Genome Browser
Species Human (GRCh38)
Location 15:73309342-73309364
Sequence GCAGTGTTCCAGGAATCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106256_1129106265 12 Left 1129106256 15:73309342-73309364 CCCCCAGATTCCTGGAACACTGC No data
Right 1129106265 15:73309377-73309399 GGGCCCAGTCAAGCTAAGTTTGG No data
1129106256_1129106264 -8 Left 1129106256 15:73309342-73309364 CCCCCAGATTCCTGGAACACTGC No data
Right 1129106264 15:73309357-73309379 AACACTGCAAGGGCAATACTGGG No data
1129106256_1129106263 -9 Left 1129106256 15:73309342-73309364 CCCCCAGATTCCTGGAACACTGC No data
Right 1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG No data
1129106256_1129106268 16 Left 1129106256 15:73309342-73309364 CCCCCAGATTCCTGGAACACTGC No data
Right 1129106268 15:73309381-73309403 CCAGTCAAGCTAAGTTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106256 Original CRISPR GCAGTGTTCCAGGAATCTGG GGG (reversed) Intergenic
No off target data available for this crispr