ID: 1129106263

View in Genome Browser
Species Human (GRCh38)
Location 15:73309356-73309378
Sequence GAACACTGCAAGGGCAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129106256_1129106263 -9 Left 1129106256 15:73309342-73309364 CCCCCAGATTCCTGGAACACTGC No data
Right 1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG No data
1129106257_1129106263 -10 Left 1129106257 15:73309343-73309365 CCCCAGATTCCTGGAACACTGCA No data
Right 1129106263 15:73309356-73309378 GAACACTGCAAGGGCAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129106263 Original CRISPR GAACACTGCAAGGGCAATAC TGG Intergenic
No off target data available for this crispr