ID: 1129109105

View in Genome Browser
Species Human (GRCh38)
Location 15:73327490-73327512
Sequence GGTGGGGCTCAGCATGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 295}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129109105_1129109117 15 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109117 15:73327528-73327550 GCACTGGTGCTGGCTCCAGAAGG 0: 1
1: 0
2: 3
3: 25
4: 245
1129109105_1129109109 -7 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109109 15:73327506-73327528 CCCCACCCCAGTCACAGGCTGGG 0: 2
1: 0
2: 3
3: 42
4: 406
1129109105_1129109118 28 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109118 15:73327541-73327563 CTCCAGAAGGATCCCTCACCTGG 0: 1
1: 0
2: 2
3: 16
4: 135
1129109105_1129109114 -1 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109114 15:73327512-73327534 CCCAGTCACAGGCTGGGCACTGG 0: 1
1: 0
2: 5
3: 32
4: 375
1129109105_1129109116 5 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109116 15:73327518-73327540 CACAGGCTGGGCACTGGTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 566
1129109105_1129109107 -8 Left 1129109105 15:73327490-73327512 CCACTCACATGCTGAGCCCCACC 0: 1
1: 0
2: 0
3: 34
4: 295
Right 1129109107 15:73327505-73327527 GCCCCACCCCAGTCACAGGCTGG 0: 2
1: 0
2: 5
3: 42
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129109105 Original CRISPR GGTGGGGCTCAGCATGTGAG TGG (reversed) Intronic
900404202 1:2485390-2485412 GGAGGGGCTCAGACTGTGTGTGG + Intronic
900596093 1:3480849-3480871 GGTGGGGCCCAGCAGCTGAGGGG - Exonic
900622228 1:3592714-3592736 GCTGGGTCCCAGCAAGTGAGGGG - Intronic
900787623 1:4658661-4658683 GGTGGGGGTGAGCATGAAAGGGG - Intronic
900788469 1:4664533-4664555 GGTGGGGATCAGCTGGTGAGAGG - Intronic
901125208 1:6924294-6924316 GGAGGGGCTCAGGCTGGGAGGGG + Intronic
901196511 1:7443299-7443321 GCTGGGGCTGAGCATGCGATGGG - Intronic
901650331 1:10739417-10739439 CATGGGGCACAGCATGTGTGTGG + Intronic
902137990 1:14327317-14327339 GCTGGGGCTCAGGAGGTGTGTGG - Intergenic
903559351 1:24216240-24216262 GGTGGGGCTCAGATTTTGATTGG + Intergenic
903806613 1:26010244-26010266 GGCTGGGCAAAGCATGTGAGAGG + Intergenic
903974045 1:27137769-27137791 GCTGAGGCTCAGCAAGGGAGGGG + Intronic
904321511 1:29700737-29700759 GGTGGGGCTTGGCTTGTTAGTGG - Intergenic
904378072 1:30094241-30094263 GGTTGGGCTCAGCATGGGGCTGG - Intergenic
905075277 1:35265231-35265253 GGCGGAGCTCTGCAAGTGAGTGG - Intergenic
905623162 1:39466674-39466696 TGTGGGGCCCAGCTTCTGAGAGG + Intronic
905865183 1:41372550-41372572 GGAGGGGCTCAGACTGAGAGGGG + Intronic
906156891 1:43619188-43619210 GGTGGTGCACTGCAGGTGAGAGG + Exonic
906162078 1:43657582-43657604 TGTGGGGCTCTGCAGGTGAAAGG + Intronic
906287557 1:44597528-44597550 GGAGGGGCACAGCGTGAGAGAGG - Intronic
907118646 1:51990375-51990397 GGTGGGGCTCACCTAGGGAGGGG - Intronic
907248530 1:53122934-53122956 TGTGGGGCTCAGAGTGTGGGCGG + Intronic
908742184 1:67340557-67340579 TGTGGGGATCAGCAAATGAGAGG + Intronic
911966852 1:104381881-104381903 GGTGGGTGTCAGCATGAGATTGG - Intergenic
913190165 1:116406753-116406775 GGTAGGGGTCAGGATGTGAGAGG - Intronic
914847101 1:151289312-151289334 GGTGGGGCGCAGGAGGGGAGGGG + Intronic
915941141 1:160119112-160119134 GGTGAGGCTGTGCATGTGTGGGG + Intronic
916683819 1:167126955-167126977 GGTGGAGCTCAGCAAGGGGGAGG + Exonic
916930663 1:169575303-169575325 GGTGGAGCTTAGTATGTGAAAGG + Intronic
918962453 1:191297916-191297938 CTTGGGTCTCAGCATGTGTGTGG + Intergenic
919779672 1:201213803-201213825 GATGGGGTCCAGCCTGTGAGAGG + Intronic
920127059 1:203701733-203701755 GGTGGGGATTAGGAAGTGAGAGG - Intronic
920303954 1:205006962-205006984 GGTGGAGGTCAGCTTGGGAGAGG + Intronic
920516335 1:206587159-206587181 GGTGGGGCACAGCCTGGGGGCGG - Exonic
922035078 1:221840065-221840087 GGTTGGGCACACCATGTGACTGG + Intergenic
923067204 1:230529013-230529035 TGTGTGTCTCTGCATGTGAGAGG - Intergenic
1063130506 10:3173226-3173248 GGTGGGGCTGTGCAAGTGATGGG + Intergenic
1065367103 10:24947710-24947732 TGTGGAGCTCAGCAGGGGAGAGG - Intronic
1065862493 10:29883514-29883536 TGAGGGACTCAGCATGGGAGAGG - Intergenic
1066298359 10:34075686-34075708 GGTGAGGGTCAGCATGTGGGCGG + Intergenic
1066518241 10:36187826-36187848 GGTGTGGCCCAGCTGGTGAGGGG - Intergenic
1067047496 10:42992748-42992770 GGTGAGGCTCAGCGGGTGACTGG + Intergenic
1069794095 10:71041353-71041375 GGCGGGGCTCAGCATGGGGCAGG + Intergenic
1070154751 10:73826472-73826494 GGAGGGGCACAGCAAGGGAGGGG + Intronic
1070506577 10:77118616-77118638 CATGGGGCTGGGCATGTGAGGGG - Intronic
1070575482 10:77674089-77674111 GGTGAGGCTCAGGAAGTGTGGGG + Intergenic
1071447190 10:85759403-85759425 GGTGGGGATCAGCTTGAGTGGGG - Intronic
1071508759 10:86248303-86248325 GGTGGGGCCCAGCATGGCAGTGG - Intronic
1074084423 10:110197064-110197086 AGTGGGGCTGATCATGTGAAGGG + Intergenic
1074676230 10:115854565-115854587 GCTGCTGCTCAGCAGGTGAGAGG - Intronic
1075969481 10:126640339-126640361 GGTGGGAATCAGCGTGTGAGTGG - Intronic
1076217406 10:128707175-128707197 TGTGGGGATCAGCCTGTGATGGG + Intergenic
1076686680 10:132201338-132201360 GGTGGGGCTGAGGATGCGGGAGG - Intronic
1076772926 10:132676902-132676924 GGTGGGGGTCACCATGTGGATGG - Intronic
1076875974 10:133215711-133215733 GGTGGGTCTCAGGCTGGGAGGGG - Intronic
1077044368 11:537888-537910 GGTGGGGCTCAGGAGGGGAGCGG + Intronic
1077921144 11:6642605-6642627 GGTGGGGCTCAGAGTGTCTGAGG + Intronic
1081663815 11:44904704-44904726 GGAGTGGCCCAGCAGGTGAGAGG + Intronic
1081664240 11:44907185-44907207 GGGTGGGCTCAGCATGTGGGTGG - Intronic
1081668657 11:44931263-44931285 GCTGGGGCTAAGCATGTGGGTGG - Exonic
1081994763 11:47356272-47356294 GGTGGGTGCAAGCATGTGAGTGG - Intronic
1082834098 11:57639508-57639530 GATGGGGCCCAGCCTGTGAAAGG - Intergenic
1083149960 11:60785702-60785724 GATGGGGCTCCGCAGGGGAGAGG - Intronic
1083200419 11:61118133-61118155 GGTGGGGGTCAGGCTGGGAGGGG - Intronic
1083300938 11:61739365-61739387 AGGGGGGCTCAGCAGGTGAGAGG - Intronic
1083812472 11:65113251-65113273 GGTGGGGCTGGGGATGTCAGCGG + Exonic
1084947341 11:72645495-72645517 GGTAGGGATCTGCGTGTGAGTGG - Intronic
1084977525 11:72810772-72810794 GGTGGGGCTAAGCTTGGCAGTGG + Intergenic
1085395993 11:76207481-76207503 GGTGGGGTTCAGCTAGGGAGCGG + Intronic
1085445236 11:76597040-76597062 GGTGGGGATCGGCATTTAAGAGG - Intergenic
1085649280 11:78252751-78252773 GGAGGTGCTCAGCAGGTGAAGGG - Intronic
1089395468 11:118133950-118133972 GGATGGGCTCTGCATGTAAGGGG - Exonic
1090226422 11:125074693-125074715 GGGAGGGCTCAGCATGAGTGTGG + Intronic
1092252917 12:6911059-6911081 GGTGGGGCTCAGGAGAAGAGAGG - Intronic
1095977157 12:47947540-47947562 GCTGGGGCTCAGGCTGTGGGAGG + Intergenic
1096642357 12:53004737-53004759 TGTGAGGCTGATCATGTGAGGGG - Intergenic
1098072886 12:66695174-66695196 AGTGGGGCTGACCATGTGTGAGG + Intronic
1098300312 12:69047596-69047618 GGTTGGGCTTAGCCAGTGAGAGG - Intergenic
1100316454 12:93449115-93449137 GGTGGGGCACACCAGGTGGGAGG - Intergenic
1102545335 12:113650413-113650435 TGTGGGGCTCTGCAGGTGAGGGG + Intergenic
1103449679 12:121019849-121019871 AGTGGGGCTAACCATGTGATTGG + Intergenic
1112375492 13:98836223-98836245 GGTGGGGCACAGGAGGAGAGGGG + Intronic
1113946916 13:114049670-114049692 GGCGGGGCTCAGCCTGTGCCGGG - Intronic
1114549368 14:23524241-23524263 GGTGGGGCTCAAAAAGCGAGTGG - Exonic
1114655511 14:24313150-24313172 GGTGGGGAACAGCTTGAGAGAGG + Intronic
1114743313 14:25120299-25120321 GGTGGGGCGCAGCATTTCAGGGG - Intergenic
1115780859 14:36766504-36766526 TGTGGGACCCAGCATGAGAGTGG - Intronic
1116538251 14:46063675-46063697 GAAGGGGCTCTGCATGTGTGGGG - Intergenic
1116723335 14:48528882-48528904 GGTGAGGCTATGCATGTGTGGGG - Intergenic
1116951593 14:50883255-50883277 GGTGGGAGCCAGCATGTGGGAGG - Intronic
1119921097 14:78446784-78446806 GTTGGGGCTCAGAAGGGGAGGGG + Intronic
1120588378 14:86345439-86345461 GGTGGGGCTCCTGAGGTGAGAGG + Intergenic
1121128586 14:91425413-91425435 GGCAGGGCCCAGCTTGTGAGAGG + Intergenic
1121365121 14:93302000-93302022 GGCTGGGCAAAGCATGTGAGGGG + Intronic
1122092473 14:99349404-99349426 GCTGGGCCCCAGCAAGTGAGCGG + Intergenic
1122861966 14:104586758-104586780 GGTGGGGCACAGCTTGGCAGAGG + Intronic
1122920444 14:104877790-104877812 GGTGGGGCTGAGCAGGTGGGTGG - Intronic
1123142491 14:106094797-106094819 GGGGGCGCTCAGGAAGTGAGGGG - Intergenic
1123974524 15:25540621-25540643 GGTTGGGCACAGTATGTGAGGGG + Intergenic
1124369565 15:29096189-29096211 GGTGGGCCTCGGCATGTCTGTGG - Intronic
1126563416 15:50070106-50070128 GGTAGGGCTCACCATATGAAAGG - Intronic
1129109105 15:73327490-73327512 GGTGGGGCTCAGCATGTGAGTGG - Intronic
1129851129 15:78794570-78794592 GATGGGGCTCACCAAGTGAATGG + Intronic
1131457929 15:92597721-92597743 GGTGGAGCACAGAATGGGAGTGG - Intergenic
1132289793 15:100691629-100691651 TTTGTGGCTCATCATGTGAGGGG + Intergenic
1132479443 16:159892-159914 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479452 16:159929-159951 TGTGGGGCACAGGCTGTGAGAGG + Intronic
1132479472 16:160002-160024 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479492 16:160075-160097 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479520 16:160185-160207 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479530 16:160222-160244 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479591 16:160441-160463 CGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479611 16:160514-160536 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479631 16:160587-160609 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132479651 16:160660-160682 TGTGGGGCACAGGCTGTGAGAGG + Intronic
1132479672 16:160733-160755 TGTGGGGCACAGGTTGTGAGGGG + Intronic
1132479690 16:160807-160829 TGTGGGGCACAGGTTGTGAGAGG + Intronic
1132630855 16:916658-916680 TCTGGGGCTCTGCATGTGGGCGG - Intronic
1132662805 16:1069119-1069141 GGAGGGGCTCTGCAGGTGTGAGG - Intergenic
1132709093 16:1258668-1258690 GGAGGGGCTCAGGATGGGGGAGG - Exonic
1132711246 16:1268938-1268960 TGTGGGGCCCAGCATGGGCGTGG + Intergenic
1133001980 16:2856430-2856452 GGTGGAGCTTAGGATGTGGGTGG - Intronic
1133265200 16:4579205-4579227 GGGGGGGCCCAGCAGGTGTGGGG + Intronic
1134574756 16:15322854-15322876 GGTGAGGCTCAACAGATGAGAGG + Intergenic
1134727688 16:16433612-16433634 GGTGAGGCTCAACAGATGAGAGG - Intergenic
1134939748 16:18278215-18278237 GGTGAGGCTCAACAGATGAGAGG + Intergenic
1135191371 16:20357553-20357575 GCTGGGGCCTAGAATGTGAGGGG + Intergenic
1136544973 16:30949544-30949566 GGTGGGGCAGAGCAAGTGGGGGG + Intronic
1136866007 16:33754535-33754557 GGGGGAGCTATGCATGTGAGGGG + Intergenic
1136922373 16:34343803-34343825 GGGAGGGCTCAGGATGTGGGAGG - Intergenic
1136982200 16:35068003-35068025 GGGAGGGCTCAGGATGTGGGAGG + Intergenic
1139592558 16:67941673-67941695 GGTGAGGCCCAGGATGTGTGGGG + Intronic
1140016616 16:71192937-71192959 GATGGGGATCAGGATGTGAGAGG - Intronic
1140045435 16:71437580-71437602 GCTGGGGACCAGCATCTGAGAGG + Intergenic
1141088112 16:81110937-81110959 GGTGGGGGCCAGGATGTAAGAGG + Intergenic
1141636957 16:85319079-85319101 TGTGGGGCCCAGCATGTCATAGG + Intergenic
1142350429 16:89576918-89576940 GGGTGGGCTCAGGCTGTGAGGGG - Intronic
1203106148 16_KI270728v1_random:1361568-1361590 GGGGGAGCTATGCATGTGAGGGG - Intergenic
1203127366 16_KI270728v1_random:1600800-1600822 GGGGGAGCTATGCATGTGAGGGG + Intergenic
1142512016 17:402043-402065 GGTGGTGGTCAGCTTCTGAGAGG + Intergenic
1142512031 17:402120-402142 GGTGGTGGTCAGCTTCTGAGAGG + Intergenic
1142742288 17:1938076-1938098 GCTGGGGCTCAGCAGCTGTGGGG - Intronic
1144737839 17:17564815-17564837 GGTGGGACTCAGCCTGGTAGGGG + Intronic
1144809434 17:17989295-17989317 GGTTGGGCTCAGGATGTGGCCGG + Intronic
1145901459 17:28493166-28493188 GGTGGGGCTCAGGCTGGCAGGGG + Intronic
1146059441 17:29596722-29596744 TGTGGGGCCCAGGATGTGCGAGG + Intronic
1146808981 17:35888465-35888487 GGCTGGGCAAAGCATGTGAGGGG + Intergenic
1147371383 17:39995295-39995317 GGTGTGGATCAGGATCTGAGGGG + Exonic
1148621112 17:49035577-49035599 GGTGGGGCCCCACATGTGTGTGG - Intronic
1148728764 17:49817267-49817289 GGTGAGGCCCAGAATGTGGGAGG + Intronic
1148818933 17:50349098-50349120 GGTGGGGGCCAGGATGTGGGAGG - Intronic
1149095959 17:52841173-52841195 GGAGAGGCTGTGCATGTGAGAGG + Intergenic
1149330487 17:55576330-55576352 GGTGGGGCTCGGGGTGGGAGTGG - Intergenic
1152519422 17:80846511-80846533 GGTGTGGCTCACCATGGGCGTGG + Exonic
1152519629 17:80847646-80847668 GGTGGGGCTCTTCCTGTGTGTGG - Intronic
1154269996 18:12911095-12911117 GGTGGGGCCCAGCGAGTGGGCGG + Intronic
1157741254 18:50095497-50095519 GCTGGGGTTCAGAATGAGAGTGG + Intronic
1158170833 18:54597459-54597481 GGTGAGGCTGAACATGTGTGAGG + Intronic
1158327350 18:56325969-56325991 GGTGGGTCTGAGGATGGGAGGGG - Intergenic
1158424424 18:57326238-57326260 GGGGTGGCTCTGCAGGTGAGGGG + Intergenic
1161040890 19:2110261-2110283 GCGGGGGCTCAGCATGGGTGGGG + Intronic
1161477898 19:4496471-4496493 GGTGGGGCTGCCCCTGTGAGGGG - Intronic
1161609956 19:5237124-5237146 GGTGGGTCTCAGGATGCCAGTGG + Intronic
1162451796 19:10759493-10759515 GGTGGGGCACAGCCTGCCAGAGG + Intronic
1163490505 19:17614806-17614828 GGGGCGGCTGAGCATGTGACTGG - Intronic
1166750789 19:45163164-45163186 AGTGCGGCTCAGCAGGTGCGAGG + Exonic
1167241328 19:48345093-48345115 GGTGGGGCAGAGCCTCTGAGAGG - Intronic
1167501603 19:49851489-49851511 CGGGGGGCTCACCATGGGAGGGG - Exonic
1167617971 19:50546692-50546714 GGTGGCGCTCAGCACGTTTGTGG + Intronic
1167797147 19:51716885-51716907 GATGGGGCTGAGGATGTGACTGG - Intronic
1167820518 19:51923375-51923397 GGTGAGGCTGAGCACATGAGTGG - Intronic
926055037 2:9769461-9769483 GGTGGGGGCAGGCATGTGAGTGG + Intergenic
927276597 2:21267399-21267421 GGTGGGGCTGAGGTTGTTAGGGG + Intergenic
929066401 2:37979428-37979450 GTTGGGGTTCAGCATGAGGGAGG + Intronic
934634520 2:95971399-95971421 GGGGGAGCTATGCATGTGAGGGG + Intronic
934665944 2:96170833-96170855 GGGGGTTCTCAGCATGTGAGCGG - Intergenic
935247328 2:101230250-101230272 GGGTGGGCTCAACATGTCAGTGG - Intronic
935604516 2:104957493-104957515 TGTGTGTCTCTGCATGTGAGAGG + Intergenic
937262901 2:120597769-120597791 TGTGAGGCTCAGCCTCTGAGCGG - Intergenic
937264623 2:120608013-120608035 AGGGGGGCTCAGGATGTCAGGGG + Intergenic
938089794 2:128424015-128424037 CCTGGGGCTCAGCATGTAAATGG + Intergenic
946644462 2:221818160-221818182 TGTGGGGCAAAGCATGTGTGGGG + Intergenic
947501617 2:230675169-230675191 GGTGGGGCTTAGCCTGTGGATGG + Intergenic
948328321 2:237144322-237144344 GGTGGGGGTCGACATGTTAGTGG - Intergenic
1169881581 20:10352429-10352451 GGTTGGGCAAAGCATGTGAGGGG + Intergenic
1170604061 20:17862958-17862980 GGTGGGGCACAGCAGGGGAGGGG - Intergenic
1171193609 20:23179898-23179920 GGTGGAGGTGAGCATGGGAGGGG - Intergenic
1171381034 20:24734385-24734407 GGGGCGGCTCAGCATGTGGCGGG - Intergenic
1173400818 20:42724384-42724406 AGTGGGGCTCAGCCAGTGAGAGG + Intronic
1173409513 20:42797483-42797505 GGTGGGGGTCAGGATGTGTAAGG - Intronic
1175324038 20:58110310-58110332 GGCAAGGCTCAGGATGTGAGGGG - Intergenic
1182065636 22:27429655-27429677 CATGTGGCTAAGCATGTGAGCGG - Intergenic
1182182880 22:28370064-28370086 GGTGGGGCTTAGCCAGTGAGAGG + Intronic
1182624262 22:31634459-31634481 GGTGGGGCTCTGAATGTGCCAGG - Intronic
1182747396 22:32616202-32616224 GGTGGGGGGCAGGAGGTGAGGGG + Intronic
1183056832 22:35311945-35311967 GGTGGGGCTTAGAAGATGAGGGG + Intronic
1183167523 22:36159119-36159141 GGTGATGCCCAGCAGGTGAGAGG - Intronic
1183707156 22:39481133-39481155 GGTGGGACGGAGCAAGTGAGGGG - Intronic
1184204281 22:42991384-42991406 GGTGGGGCTCAGGCTGAGAAAGG - Intronic
1184245727 22:43234940-43234962 GGCTGGGGTCAGCAGGTGAGAGG - Intronic
1184415172 22:44348000-44348022 GGTGGGGGTCAGGATTAGAGTGG - Intergenic
1184512325 22:44940892-44940914 GGTGGGGCTGTGGAGGTGAGTGG + Intronic
1184738621 22:46413853-46413875 GGTGGGGCTCACAAAGTGAGGGG - Intronic
1185358377 22:50389170-50389192 GATGGGAGTCAGGATGTGAGAGG + Intronic
952814567 3:37435948-37435970 GGTGGTTCACAGAATGTGAGAGG - Intergenic
953980048 3:47409077-47409099 GGTGGGGCTCACCTGGGGAGAGG - Exonic
954614368 3:51962012-51962034 GGTGGGGCACAGCGTGTCAGGGG + Exonic
955666123 3:61350663-61350685 GGAGGGGCTCAGCCTGAGGGAGG + Intergenic
956574573 3:70737967-70737989 GATGGAGTTCAGCATGTGTGTGG + Intergenic
956697528 3:71931189-71931211 GGAGGGGCTAACCATGTGAAAGG - Intergenic
958037194 3:88184199-88184221 TGTGTGTCTCTGCATGTGAGAGG - Intergenic
958050519 3:88338415-88338437 AGTGGGCCTCAGGATGGGAGCGG + Intergenic
961518219 3:127451578-127451600 GGTGGGGCTCAGCCCGGGACAGG + Intergenic
961552380 3:127676770-127676792 GGAGGGCCTCAGCATGTGGGTGG - Intronic
961623691 3:128244300-128244322 GCTTGGGCTCAGCTTGTGTGAGG + Intronic
965102694 3:164321356-164321378 TGTGGGCCATAGCATGTGAGAGG - Intergenic
965385238 3:168037967-168037989 TGTGGGGCGCAGCAGGTGAGTGG + Intronic
966734745 3:183179768-183179790 GGTGGGCCTCAGCCTGCCAGCGG - Intronic
967171624 3:186826920-186826942 GGTGGGCCTCAGCCTGCCAGCGG + Intergenic
967964854 3:194953034-194953056 GGTGGGGCTCAGCATCTGGATGG - Intergenic
968552423 4:1230442-1230464 GGAGGGGCTGCGCATGCGAGCGG + Intronic
968588937 4:1448265-1448287 TGTGGGGCTCTGGATCTGAGTGG + Intergenic
968649165 4:1753612-1753634 TCAGGGGCTCAGCATGTGGGCGG + Intergenic
968657694 4:1785705-1785727 GCTGGGGCTCAGCAGGTTTGAGG + Intergenic
971188314 4:24402423-24402445 GGTGGTGCTAGGCATGTGACAGG + Intergenic
972379053 4:38501857-38501879 GGTGGTGCTCACCATGTGCCAGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
974921718 4:68250335-68250357 GGAGAGGCTAAGCATGTGTGGGG - Intergenic
975827880 4:78338806-78338828 GGCGGGGCACAGCAAGTCAGTGG + Intronic
978400001 4:108321298-108321320 GGGGAGGCTCTGCATGTGTGGGG + Intergenic
979321728 4:119332709-119332731 GCTGGGGCTGAGCAGGAGAGGGG - Intergenic
979881794 4:125969464-125969486 GGGGAGGCTCTGCATGTTAGGGG + Intergenic
981160644 4:141494775-141494797 GGTGAGTCTCATCCTGTGAGTGG + Intergenic
982100744 4:151965323-151965345 GGTTGGGTTCAGCCAGTGAGAGG + Intergenic
982265324 4:153533398-153533420 GGTGAGGCTCAGCACCTGATTGG - Intronic
982375830 4:154689518-154689540 GGGGGTGATGAGCATGTGAGTGG - Intronic
983239706 4:165218312-165218334 GCTGGGGCTGAGCAGGAGAGGGG - Intronic
985059859 4:186066737-186066759 TGTGTAGTTCAGCATGTGAGTGG + Intergenic
986662903 5:10074958-10074980 GGCAGGGCTCAGCTTGTGGGAGG - Intergenic
986662909 5:10074980-10075002 GGCAGGGCTCAGCTTGTGGGGGG - Intergenic
986662917 5:10075002-10075024 GGCAGGGCTCAGCTTGTGGGGGG - Intergenic
986662925 5:10075024-10075046 GGCAGGGCTCAGCTTGTGGGGGG - Intergenic
992103753 5:73432899-73432921 GGTGGGGGTCCGAATGTAAGAGG - Intergenic
993618659 5:90142775-90142797 GGTGGGACTCTGCAGGTGGGTGG - Intergenic
995780534 5:115770525-115770547 GCTGGAGCTCAGCGAGTGAGAGG - Intergenic
997280359 5:132639743-132639765 CCAGGGGCTCTGCATGTGAGTGG + Intronic
997625538 5:135328349-135328371 AGTGGTGCTCAGCATCTGATGGG + Intronic
997810743 5:136965580-136965602 CCTGGGGCTCAGCATGGGAAAGG + Intergenic
998005036 5:138651186-138651208 GGGGTGGTTCAGGATGTGAGTGG - Intronic
998139708 5:139693000-139693022 GAAGGGGCCCAGCATGTGGGTGG - Intergenic
998159762 5:139806783-139806805 GCTTGGGCTCAGCAAGAGAGGGG + Intronic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
998295929 5:140968493-140968515 GGTAGGGTACAGAATGTGAGGGG - Exonic
999184103 5:149692573-149692595 GGTGGGGCTCAGCCTGTTCAGGG - Intergenic
999598650 5:153235226-153235248 GGTGGGGCTCACTATGTGCCAGG + Intergenic
1001473814 5:172035172-172035194 GGTGGGTCTCAGCCAGTGACTGG - Intergenic
1002000778 5:176195262-176195284 GGTGGAGCTCAGCCTCTGTGGGG + Intergenic
1002253558 5:177943708-177943730 GGTGGAGCTCAGCCTCTGTGGGG - Intergenic
1002433565 5:179218242-179218264 GGTGGGGCTCCTCATGTTGGAGG - Intronic
1002461425 5:179375836-179375858 GGAGGAGCTCAGCAGGGGAGGGG + Intergenic
1006388941 6:33747454-33747476 TGGGGGGCTCAGCAAGTCAGAGG + Intergenic
1007668792 6:43534480-43534502 GGTGGGGGACAGCATGTGTTGGG - Intronic
1007809964 6:44478594-44478616 GGTGGGTGGCAGCATCTGAGGGG + Intergenic
1008466896 6:51841654-51841676 AGAGGGGCTCAGCATGGGAATGG + Intronic
1009940477 6:70282986-70283008 GTTGGGGCTCTGCTTGTGCGCGG - Intronic
1010375258 6:75161211-75161233 GGTGGGGGTCACCATCTGTGTGG - Intronic
1013235747 6:108196676-108196698 AGTGGGACTCAGCAAGTGTGAGG + Intergenic
1017541715 6:155409355-155409377 GGTGGGACACAGCTAGTGAGTGG + Intronic
1017962677 6:159234678-159234700 GCTGCGGCTCAGGATCTGAGGGG + Intronic
1019295596 7:272395-272417 AGTGGAGCTCAGCACGTGAGGGG - Intergenic
1019659089 7:2213831-2213853 GATGCGGCTCAGCATGGGACAGG - Intronic
1021451161 7:20784938-20784960 GGCGGGGCTGAGCAGGTGCGAGG + Exonic
1021562903 7:21986621-21986643 CGTGGGGCTCAGTATCTGATGGG - Intergenic
1022299542 7:29090195-29090217 AGTGGGGCTTAGCCTGTGAGGGG - Intronic
1023082596 7:36539264-36539286 GGTTGGGCTCAGGAGGTGAGTGG + Intronic
1024085855 7:45890717-45890739 GGTGAGGCCCAGCAGGTGGGTGG + Exonic
1024772387 7:52738502-52738524 GGGGAGGCTCTGCATGTGGGGGG - Intergenic
1026857190 7:73762582-73762604 GGTGGGGCTCAGCAAGGGGAAGG - Intergenic
1029156311 7:98520497-98520519 GGCGGGGCTCTGGATGAGAGTGG + Intergenic
1029156344 7:98520604-98520626 GGTGGGGCTCTGGCTGGGAGTGG + Intergenic
1029156415 7:98520864-98520886 GGTGGGGCTCTGGATGAGAGTGG + Intergenic
1029714378 7:102317952-102317974 GGTGGGGTTCAGCATTGGAGGGG + Intronic
1029736375 7:102467986-102468008 GGTGGGGTCCAGCCTGTGATGGG + Intronic
1032132320 7:129240292-129240314 GGTGGGTCTCAGGGTGTGTGTGG - Intronic
1033490251 7:141836463-141836485 GGTGGGGCACTTCATGGGAGGGG - Exonic
1033675256 7:143534919-143534941 GGTGGGCTTCAGCATTTGGGTGG + Intergenic
1033696581 7:143794519-143794541 GGTGGGCTTCAGCATTTGGGTGG - Intergenic
1033995266 7:147337954-147337976 GATGGGGCACTGCATCTGAGTGG + Intronic
1034758977 7:153653074-153653096 GGGGGGGCTGTGCATGTGTGGGG + Intergenic
1035212374 7:157337441-157337463 GGTGGGGCCCGGCCTGGGAGCGG + Intronic
1035227837 7:157443345-157443367 TGTGGGGCTCAGCATGTCTGCGG + Intergenic
1035557201 8:576377-576399 GGTGGGGCTTAGCATGCGTTGGG - Intergenic
1038655936 8:29451445-29451467 TGTGTGTCTCTGCATGTGAGGGG - Intergenic
1039149337 8:34485746-34485768 GGTGGGGCTGTGGATGTGAAAGG - Intergenic
1040839524 8:51770420-51770442 GGAGGGGCTCAGCATGGGGACGG + Intronic
1040985067 8:53285072-53285094 AGGGGAGCTCAGCATGTGAGTGG - Intergenic
1042501241 8:69511628-69511650 GGAGGGGCTGTGCATGTGTGAGG - Intronic
1042665440 8:71199491-71199513 AATGGGGGTCAGCATGGGAGTGG - Intronic
1043097676 8:75996500-75996522 GGAAGAGCTCAGCATGTCAGAGG + Intergenic
1043794280 8:84516035-84516057 GGTGGGGCTGAGAGTGGGAGAGG + Intronic
1044521801 8:93207184-93207206 TGCAGGGCCCAGCATGTGAGTGG + Intergenic
1045524490 8:102930100-102930122 GGTGCAGCCCAGCAGGTGAGGGG + Intronic
1046111749 8:109733974-109733996 GGTGGGGTGCAGCATTAGAGAGG + Intergenic
1048291429 8:133184602-133184624 GCTGTGGCTCAGGATCTGAGTGG + Intergenic
1049021569 8:139960817-139960839 GGTGGGGCTCAGCTTGCATGGGG + Intronic
1049230835 8:141480329-141480351 GGTGGGGCTCACCTTCTCAGGGG + Intergenic
1049328855 8:142039057-142039079 GGCGGTGCTCAGCAAGGGAGAGG + Intergenic
1051509007 9:17856894-17856916 GGTGGGCTCCAGCTTGTGAGGGG + Intergenic
1056096928 9:83264536-83264558 GGGGAGGCTGAGCATGTGTGAGG + Intronic
1057504315 9:95620069-95620091 GGTGAGGTTCAGCATGAGTGAGG - Intergenic
1057788906 9:98109672-98109694 GAAGGGGCTCTGCAAGTGAGGGG - Intronic
1057968569 9:99530121-99530143 GGTGGGGCTCCTCATGCTAGAGG + Intergenic
1059390325 9:113995774-113995796 TGTCGGGCTCAGAAAGTGAGTGG - Intronic
1059624626 9:116049410-116049432 CATGTGGCTTAGCATGTGAGTGG - Intergenic
1061274159 9:129559770-129559792 CTTGAGGCTCAGCATGGGAGAGG - Intergenic
1061424730 9:130491849-130491871 TGTGGGGCCCTGCATGTCAGCGG - Intronic
1062282198 9:135757089-135757111 GGTGGGGCCCAGCAGGGGAGGGG - Intronic
1062439544 9:136563585-136563607 GGTGCAGCTCAGCATGTGGGAGG - Intergenic
1062461058 9:136662754-136662776 GGTGGGGGCCACCGTGTGAGGGG - Intronic
1062563818 9:137154804-137154826 CAAGGAGCTCAGCATGTGAGAGG - Intronic
1062565247 9:137161434-137161456 GGTGGGGACCAGCGTGAGAGGGG + Intronic
1187675382 X:21711128-21711150 TGTGGGACTCAGCATGTGCTCGG + Intronic
1188945524 X:36296435-36296457 TGAGTGGCTCAACATGTGAGTGG + Intronic
1189250493 X:39597576-39597598 TGTTGGCCTCAGCATGTGAAGGG - Intergenic
1190483931 X:50905377-50905399 GGTGGAGCTCTGCAAGCGAGAGG - Intergenic
1194131886 X:90091472-90091494 GGAGCTGCTTAGCATGTGAGTGG + Intergenic
1199221096 X:145316393-145316415 GCTGGGGCTATGCAAGTGAGTGG - Intergenic
1199581592 X:149365951-149365973 GCTGGGGCTGAGCATGGGACAGG + Intergenic
1201705327 Y:16930227-16930249 TGTGTGTCTCTGCATGTGAGAGG - Intergenic
1202585978 Y:26428063-26428085 GGGGGAGCTATGCATGTGAGGGG - Intergenic