ID: 1129109301

View in Genome Browser
Species Human (GRCh38)
Location 15:73328378-73328400
Sequence ATGCTCCTCAAATGCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 907}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129109293_1129109301 16 Left 1129109293 15:73328339-73328361 CCCAGGGCAGGAGCTGAGCATGA 0: 1
1: 0
2: 2
3: 31
4: 302
Right 1129109301 15:73328378-73328400 ATGCTCCTCAAATGCCAGGCTGG 0: 1
1: 0
2: 3
3: 37
4: 907
1129109294_1129109301 15 Left 1129109294 15:73328340-73328362 CCAGGGCAGGAGCTGAGCATGAG 0: 1
1: 0
2: 2
3: 26
4: 361
Right 1129109301 15:73328378-73328400 ATGCTCCTCAAATGCCAGGCTGG 0: 1
1: 0
2: 3
3: 37
4: 907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129109301 Original CRISPR ATGCTCCTCAAATGCCAGGC TGG Intronic
900530278 1:3149625-3149647 AGGCTTCACAAATGCCAGCCTGG - Intronic
901030764 1:6305570-6305592 ACGCTCCTCACATCCCAGACGGG + Intronic
901100549 1:6715615-6715637 ATGCTCCTCACATCCCGGACGGG + Intergenic
901180208 1:7336518-7336540 ATGCTCCTGAGAGGCCAGGGTGG - Intronic
901224005 1:7601322-7601344 ACGCTCCTCACATCCCAGACGGG + Intronic
901224046 1:7601514-7601536 ATGCTCCTCACTTCCCAGACAGG + Intronic
901341214 1:8500824-8500846 GTGCTCCTCACATCCCAGACAGG - Intronic
901855777 1:12043328-12043350 ATGCTCCTCACCTCCCAGACGGG - Intergenic
902671295 1:17975895-17975917 ATGCCCCCCAAATGCCAGGAGGG - Intergenic
903008506 1:20314306-20314328 ATGTTCCCTAAGTGCCAGGCTGG - Exonic
903103364 1:21053195-21053217 ACGCTCCTCACATCCCAGACGGG - Intronic
903426372 1:23257235-23257257 ATGCTCCTCACTTCCCAGACGGG - Intergenic
904930287 1:34082130-34082152 GTGCTCCTCACATCCCAGACGGG - Intronic
905527057 1:38647503-38647525 ACGCTCCTCACATCCCAGACGGG - Intergenic
905599185 1:39234807-39234829 ATGCTCCTCACCTCCCAGACGGG + Intronic
905599196 1:39234847-39234869 GTGCTCCTCACATCCCAGACGGG + Intronic
905686616 1:39913200-39913222 ACGCTCCTCACATCCCAGACGGG + Intergenic
905754686 1:40499017-40499039 ATGCCCCTCAGATGGCAGACAGG - Intergenic
905907317 1:41627678-41627700 CTGCTCCTGGCATGCCAGGCTGG + Intronic
906355843 1:45105829-45105851 GTGCTCCTCACATCCCAGACGGG - Intronic
906956788 1:50381627-50381649 ACGCTCCTCACATCCCAGACGGG - Intergenic
907009820 1:50952762-50952784 ATGCTCCTCACCTCCCAGACGGG - Intronic
907026469 1:51125021-51125043 TTACTCCTCCAATGCTAGGCAGG - Intronic
907089657 1:51711714-51711736 ATGCTCCTCACCTCCCAGACGGG + Intronic
908131456 1:61079838-61079860 ATGTTCCTCAAAGGGCAGACTGG - Intronic
908485778 1:64591444-64591466 AGGATCCTCAAATGCTAGACTGG + Intronic
909479059 1:76112719-76112741 ACGCTCCTCACATCCCAGACGGG + Intronic
909479102 1:76112911-76112933 ATGCTCCTCACTTCCCAGACGGG + Intronic
910673806 1:89798114-89798136 ATGCTCCTCACCTCCCAGACGGG + Intronic
910673818 1:89798154-89798176 GTGCTCCTCACATCCCAGACGGG + Intronic
910891668 1:92026187-92026209 ATGCTCCTCACCTCCCAGACGGG + Intergenic
911325895 1:96469974-96469996 GTGCTCCTCACATCCCAGACGGG + Intergenic
911486710 1:98512912-98512934 ATGCTCCTCACTTCCCAGACGGG + Intergenic
911486760 1:98513109-98513131 ATGCTCCTCACTTTCCAGACTGG + Intergenic
911569728 1:99508129-99508151 ATGTTCCTCACATCCCAGACGGG - Intergenic
912116303 1:106412567-106412589 ATGCTCCTCACTTCCCAGACGGG - Intergenic
912302998 1:108536275-108536297 ACGCTCCTCACATCCCAGACGGG + Intergenic
912663185 1:111553345-111553367 ATGCTCCTCAAATTCCACAGAGG - Intronic
912667764 1:111598442-111598464 GTGCTCCTCAAAGGGTAGGCAGG - Intronic
912669113 1:111608242-111608264 GCGCTCCTCACATCCCAGGCGGG + Intronic
913021212 1:114790962-114790984 ATGCTCCTCACTTTCCAGACTGG + Intergenic
913022885 1:114804904-114804926 ATGCTCCTCACTTCCCAGACGGG + Intergenic
913306289 1:117430707-117430729 ATGCTCCTCACTTTCCAGACTGG + Intronic
914002082 1:143702678-143702700 ACGCTCCTCACATCCCAGACGGG - Intergenic
914220662 1:145679063-145679085 TTGCTACTAAAATGCCAGCCTGG - Intronic
914231569 1:145767354-145767376 ACGCTCCTCACATCCCAGACGGG + Intronic
914468355 1:147950275-147950297 GTGCTCCTCACATCCCAGACGGG + Intronic
914787868 1:150850704-150850726 ATGCTCCTCACTTCCCAGACGGG - Intronic
914893866 1:151651543-151651565 ATGCTCCTCACCTCCCAGACGGG + Intronic
914893877 1:151651583-151651605 GTGCTCCTCACATCCCAGACGGG + Intronic
914893905 1:151651699-151651721 ATGCTCCTCACTTTCCAGACTGG + Intronic
914953950 1:152144902-152144924 ATGCTCCTCACTTCCCAGACGGG + Intergenic
914965877 1:152256646-152256668 ATGCTCCTCACTTTCCAGACTGG + Intergenic
914987365 1:152472195-152472217 ATGCTCCTCACCTCCCAGACGGG + Intergenic
915470794 1:156124625-156124647 TAGCACCTCAAATGCCAGGGAGG + Intronic
915539154 1:156556946-156556968 GTGCTCCTCACATCCCAGACAGG - Intronic
915992733 1:160532627-160532649 GTGCTCCTCACATCCCAGACGGG - Intergenic
916087489 1:161281651-161281673 ATGCTCCTCACTTCCCAGACGGG + Intronic
916320439 1:163498803-163498825 GTGCTCCTCACTTCCCAGGCGGG + Intergenic
916800056 1:168207992-168208014 GTGCTCCTCACATCCCAGACGGG + Intergenic
917006115 1:170418751-170418773 ATGCTCCTTACATTCCAGACTGG - Intergenic
917027300 1:170658490-170658512 CTGCTCCTCAAATCACTGGCTGG - Intergenic
917126692 1:171694067-171694089 GTGCTCCTCACATCCCAGACGGG + Intergenic
917304567 1:173613205-173613227 GTGCTCCTCACATCCCAGACGGG - Intronic
917304620 1:173613402-173613424 ATGCTCCTCACTTCCCAGACGGG - Intronic
917859805 1:179135152-179135174 ATGCTCCTCACTTCCCAGACGGG - Intronic
917859824 1:179135228-179135250 ATGCTCCTCACTTTCCAGACTGG - Intronic
918172467 1:182010920-182010942 ATGCTCCTCACCTCCCAGACGGG - Intergenic
918221444 1:182440011-182440033 GTGCTCCTCACATCCCAGACGGG + Intergenic
918255416 1:182742236-182742258 ATGCTCCTCACTTTCCAGACTGG + Intergenic
918812489 1:189139839-189139861 ATGCTCCTCACTTCCCAGACGGG + Intergenic
919625285 1:199904681-199904703 ACGCTCCTCACATCCCAGACGGG + Intergenic
920214589 1:204353030-204353052 ATGCTCCTTATGTACCAGGCAGG - Intronic
921142729 1:212321569-212321591 ACGCTCCTCACATCCCAGACAGG + Intronic
921238403 1:213152541-213152563 ATGCTCCTCACCTCCCAGACGGG + Intronic
921238415 1:213152581-213152603 GTGCTCCTCACATCCCAGACGGG + Intronic
921238471 1:213152813-213152835 ATGCTCCTCACTTCCCAGACGGG + Intronic
922278492 1:224100871-224100893 ACGCTCCTCACATCCCAGACGGG - Intergenic
922306518 1:224349889-224349911 ATGCTCCTCACTTCCCAGACGGG + Intergenic
922632831 1:227132982-227133004 ATGCTCCTCACTTCCCAGACGGG - Intronic
922644868 1:227276256-227276278 ACGCTCCTCAGATCCCAGACGGG - Intronic
922688402 1:227666348-227666370 ATGCAGCTCAAAAGCCAGGATGG - Intronic
923174897 1:231454324-231454346 ATGCTCCTCACTTCCCAGACGGG - Intergenic
923560291 1:235034847-235034869 AAGCTCCTTAAATGCCAGACGGG - Intergenic
923710712 1:236386411-236386433 ATGCTCCTCACTTTCCAGACTGG - Intronic
923741076 1:236655633-236655655 ATGCCCCACAAATATCAGGCAGG + Intergenic
923793043 1:237127686-237127708 ATGCTCCTCACCTCCCAGACGGG + Intronic
923793055 1:237127726-237127748 GTGCTCCTCACATCCCAGACGGG + Intronic
923840883 1:237669630-237669652 ACGCTCCTCACATCCCAGACGGG + Intronic
924634751 1:245775121-245775143 ATGCTCCTCACCTCCCAGACGGG - Intronic
924765918 1:247032063-247032085 ATGCTCCTCACTTTCCAGACTGG - Intergenic
924824061 1:247521802-247521824 ATGCTCCTCACTTCCCAGACGGG - Intronic
924943693 1:248830268-248830290 ATGCTCCTCACACCCCAGACGGG - Intergenic
1064357352 10:14631774-14631796 ATTCCTCTCCAATGCCAGGCTGG + Intronic
1064985861 10:21209122-21209144 ATTCTGCCCAAATTCCAGGCAGG + Intergenic
1065088165 10:22201722-22201744 AAGCTTATCAAATTCCAGGCTGG - Intergenic
1065738024 10:28771790-28771812 GTGCTCCTCATATCCCAGACGGG - Intergenic
1065840384 10:29696763-29696785 ATGCTCCTCACTTCCCAGACGGG - Intronic
1066141193 10:32505934-32505956 GTGCTCCTCACATCCCAGACGGG + Intronic
1066390894 10:34976610-34976632 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1066818747 10:39456114-39456136 ATGTTCCTCACATCCCAGACGGG + Intergenic
1066952900 10:42138274-42138296 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1067026429 10:42847316-42847338 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1067034084 10:42900207-42900229 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1067117460 10:43446538-43446560 ATGCTCCTCACCTCCCAGACGGG + Intronic
1067333922 10:45346601-45346623 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1067334142 10:45347404-45347426 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1067334203 10:45347632-45347654 GTGCTCCTCACATCCCAGACGGG - Intergenic
1067776335 10:49167401-49167423 AGGCTCCTCAAAGGCCAGACAGG - Intronic
1068923040 10:62505207-62505229 ATGTTTCTCAAAAGCCTGGCTGG + Intronic
1068969580 10:62947716-62947738 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1069365564 10:67691314-67691336 ATGCTCCTCACTTCCCAGACGGG - Intronic
1069674880 10:70239765-70239787 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1069929031 10:71869902-71869924 ACGCTCCTCACATCCCAGACGGG + Intergenic
1069930080 10:71876037-71876059 ACGCTCCTCACATCCCAGACGGG + Intergenic
1070367458 10:75750657-75750679 ATGCTCCTCACTTCCCAGACGGG + Intronic
1070566323 10:77606167-77606189 ATACTGCTGAAATACCAGGCTGG + Intronic
1070571221 10:77640285-77640307 ATTCCCCTGAAATGCCAGTCTGG + Intergenic
1070684217 10:78469181-78469203 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1070966426 10:80534003-80534025 ACGCTCCTCACATCCCAGACGGG - Intergenic
1071225169 10:83520591-83520613 GTGCTCCTCACATCCCAGACGGG - Intergenic
1072258824 10:93647402-93647424 ATGGTCCTCATAAGCCAAGCAGG + Intronic
1074249475 10:111730278-111730300 ATGCTCCTCAGAGGCAGGGCTGG + Intergenic
1075108516 10:119559586-119559608 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1075842707 10:125518191-125518213 ACGCTCCTCACTTCCCAGGCGGG - Intergenic
1076721683 10:132396033-132396055 GTGGTCCTCAATTCCCAGGCTGG + Intergenic
1077040129 11:517270-517292 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1077485039 11:2834745-2834767 ATGGGCCTCGAATGCCAGGCAGG + Intronic
1077668463 11:4137319-4137341 GTGCTCCTCACATCCCAGACGGG + Intronic
1077837045 11:5934660-5934682 GTGCTCCTCACATCCCAGACGGG - Intronic
1078122437 11:8523606-8523628 ATGCTCCTCACTTCCCAGACGGG - Intronic
1079020523 11:16906823-16906845 ATGCTCCTCACTTTCCAGACTGG - Intronic
1079020548 11:16906939-16906961 ACGCTCCTCACATCCCAGACGGG - Intronic
1079107297 11:17579655-17579677 ATACTCTTCAAATGCCACTCCGG - Intronic
1080601860 11:33828949-33828971 AGGCGCCTCAAAAGCCAGCCTGG + Intergenic
1080838380 11:35961524-35961546 GTGCTCCTGAAATGCCAGCATGG - Intronic
1080860023 11:36144543-36144565 ACGCTCCTCACATCCCAGACGGG - Intronic
1080983053 11:37431102-37431124 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1080983217 11:37431747-37431769 GTGCTCCTCACATCCCAGACGGG + Intergenic
1082064909 11:47892190-47892212 AAGCTCCTTACATGCCAGACTGG - Intergenic
1082166470 11:48955828-48955850 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1082166480 11:48955868-48955890 ACGCTCCTCAGATCCCAGACAGG + Intergenic
1082258956 11:50063101-50063123 GTGCTCCTCACATCCCAGACGGG + Intergenic
1083091253 11:60201492-60201514 GTGCTCCTCACATCCCAGACAGG + Intronic
1083114948 11:60451338-60451360 GTGCTCCTCACATCCCAGACGGG - Intronic
1083120818 11:60510414-60510436 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1083130615 11:60621799-60621821 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1083208348 11:61166828-61166850 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1083865391 11:65450893-65450915 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1084565822 11:69928235-69928257 AGGATTCCCAAATGCCAGGCAGG + Intergenic
1084839208 11:71831439-71831461 GTGCTCCTCACATGCCAGACGGG - Intergenic
1084943870 11:72628646-72628668 AGTCTCCTCACCTGCCAGGCGGG - Intronic
1085073661 11:73571743-73571765 ATGCTCCTCACTTTCCAGACTGG - Intronic
1085112142 11:73897755-73897777 ATGCTCCTCACTTCCCAGACAGG + Intronic
1085492519 11:76933989-76934011 GTGCTCCTCACATCCCAGACGGG + Intronic
1085822148 11:79804511-79804533 ACGCTCCTCACATCCCAGACGGG - Intergenic
1086697226 11:89860674-89860696 ACGCTCCTCACATCCCAGACGGG - Intergenic
1086708933 11:89983813-89983835 ACGCTCCTCACATCCCAGACGGG + Intergenic
1086881398 11:92157309-92157331 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1086881453 11:92157541-92157563 GTGCTCCTCACATCCCAGACGGG - Intergenic
1087214732 11:95482512-95482534 ATGCTCCTCACCTCCCAGACAGG - Intergenic
1087573207 11:99957230-99957252 ATGCTACTCTAATGCCAGAAAGG + Intronic
1088116265 11:106317447-106317469 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1088116366 11:106317839-106317861 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1089162782 11:116452329-116452351 GTGCTACTCAAATGCCACGGGGG - Intergenic
1089421188 11:118332223-118332245 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1089698911 11:120232417-120232439 ATGCTCCTCAGATACAATGCTGG - Intergenic
1091586166 12:1818098-1818120 ACGCTCCTCACATCCCAGACGGG - Intronic
1092453511 12:8624974-8624996 GTGCTCCTCACATCCCAGACAGG - Intergenic
1092850081 12:12618604-12618626 ACGCTCCTCACTTCCCAGGCGGG + Intronic
1093038492 12:14354727-14354749 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1094209386 12:27873986-27874008 ACGCTCCTCACATCCCAGACGGG - Intergenic
1094239095 12:28201369-28201391 GAGCTCCTCACATCCCAGGCGGG + Intronic
1094319736 12:29171692-29171714 GTGCTCCTCACATGCCAGATGGG - Intronic
1094717038 12:33023202-33023224 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1095113979 12:38330846-38330868 ATGCTCCTCACTTCCCAGACAGG + Intergenic
1095281126 12:40353324-40353346 ATGCTCCTCACCTCCCAGACAGG + Intronic
1096054824 12:48642173-48642195 ACGCTCCTCACATCCCAGACGGG - Intergenic
1096054875 12:48642361-48642383 GTGCTCCTCACATCCCAGACGGG - Intergenic
1096082331 12:48841959-48841981 ACGCTCCTCACATCCCAGACGGG - Intronic
1096167612 12:49437210-49437232 ACGCTCCTCACATCCCAGACGGG + Intronic
1096441102 12:51644970-51644992 ATGCTCCTCACTTCCCAGACGGG - Intronic
1096556975 12:52409686-52409708 ACGCTCCTCACATCCCAGACGGG - Intergenic
1096951712 12:55479650-55479672 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1096988772 12:55781264-55781286 AAGCTCCTCAAAAACAAGGCAGG + Intronic
1097089405 12:56494011-56494033 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1097089617 12:56494708-56494730 GTGCTCCTCACATCCCAGACGGG + Intergenic
1097127134 12:56783978-56784000 ATGCTCCTCACCTCCCAGACGGG + Intronic
1097128108 12:56789777-56789799 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1097128152 12:56789934-56789956 GTGCTCCTCACATCCCAGACGGG + Intergenic
1097138484 12:56879350-56879372 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1097230630 12:57508234-57508256 ATGCTCCTCACTTCCCAGACTGG + Intronic
1097779521 12:63686772-63686794 GTGCTCCTCACATCCCAGACAGG - Intergenic
1098379620 12:69853920-69853942 ATGCTCCTCACTTCCCAGACGGG + Intronic
1098883750 12:75941854-75941876 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1100048216 12:90411148-90411170 ACGCTCCTCACCTCCCAGGCGGG - Intergenic
1100507606 12:95235840-95235862 ACGCTCCTCACATCCCAGACGGG + Intronic
1100577674 12:95907938-95907960 ATGCTCCTCACTTTCCAGACTGG + Intronic
1102268301 12:111507435-111507457 ATGCTCCTCACTTCCCAGACGGG - Intronic
1102323303 12:111957322-111957344 ATGCTCCTCACCTCCCAGACGGG - Intronic
1102641429 12:114370588-114370610 AGTGTCCTCACATGCCAGGCAGG + Intronic
1103350180 12:120278393-120278415 GTGCTCCTCACATCCCAGACAGG + Intergenic
1103456991 12:121075917-121075939 ACGCTCCTCACATCCCAGACGGG - Intergenic
1103872716 12:124102440-124102462 ACGCTCCTCACTTTCCAGGCTGG + Intronic
1103872735 12:124102516-124102538 ATGCTCCTCACTTCCCAGACGGG + Intronic
1105267754 13:18837043-18837065 GTGCTCCTCAATTCCCAGCCAGG + Intergenic
1105267762 13:18837078-18837100 ATGCTCCTCACATCCCAGACAGG + Intergenic
1105267875 13:18837527-18837549 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1105367623 13:19778869-19778891 ATGCTCCTCACTTTCCAGACTGG - Intronic
1105527102 13:21186715-21186737 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1105527113 13:21186755-21186777 GTGCTCCTCACATCCCAGACGGG + Intergenic
1105692908 13:22859399-22859421 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1105968257 13:25404319-25404341 TTGCTCCACAAATGCCAGCCAGG - Intronic
1105976892 13:25480653-25480675 ATGCTCCTCACTTTCCAGACTGG + Intronic
1105980605 13:25513299-25513321 GTGCTCCTCACATCCCAGACGGG + Intronic
1106652939 13:31711386-31711408 ATGCTCCTCGCATGCCAGGCTGG + Intergenic
1106680058 13:31999902-31999924 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1106747706 13:32721622-32721644 GTGCTCCTCACATCCCAGACGGG + Intronic
1106747779 13:32721930-32721952 ATGCTCCTCACCTCCCAGACGGG + Intronic
1107165748 13:37280075-37280097 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1107498819 13:40955062-40955084 ACGCTCCTCACATCCCAGACAGG - Intronic
1107588946 13:41882145-41882167 GTGCTCCTCACATCCCAGACGGG + Intronic
1107692401 13:42966281-42966303 ATGCTCCTCACTTTCCAGACTGG - Intronic
1107737755 13:43416628-43416650 ACGCTCCTCACATCCCAGACCGG + Intronic
1107863587 13:44682896-44682918 ACGCTCCTCAATTTCCAGACTGG + Intergenic
1109798310 13:67344116-67344138 ATGCTCCTTGAAGGCCAGGAAGG - Intergenic
1110269275 13:73574638-73574660 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1111388563 13:87561628-87561650 GCGCTCCTCACATGCCAGACGGG - Intergenic
1111482729 13:88852539-88852561 GTGCTCCTCAATTCCCAGACAGG + Intergenic
1113479030 13:110606627-110606649 ATGCTCCTCACATCCCAGACGGG + Intergenic
1113566127 13:111320740-111320762 CTGCGCCTCACATCCCAGGCGGG - Exonic
1114137175 14:19866132-19866154 ACGCTCCTCACATCCCAGACGGG - Intergenic
1114336651 14:21697867-21697889 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1114507811 14:23232065-23232087 ACGCTCCTCACATCCCAGACGGG - Intronic
1115324866 14:32127830-32127852 ATGCTCCTCACTTCCCAGACGGG + Intronic
1115504208 14:34078739-34078761 ATGCTCCTCACTTCCCAGACGGG - Intronic
1115847708 14:37555892-37555914 GTGCTCCTCACATCCCAGACGGG + Intergenic
1115847762 14:37556124-37556146 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1116825669 14:49671277-49671299 AAGCACCTCAAATGCAAGGCAGG + Intronic
1116841031 14:49821039-49821061 GTGCTCCTCACATCCCAGACGGG - Intronic
1117270536 14:54138887-54138909 CTGCTTCACAAATGTCAGGCTGG - Intergenic
1117276937 14:54203117-54203139 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1117411784 14:55456769-55456791 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1117468987 14:56023305-56023327 TTGCTCCACATAGGCCAGGCTGG + Intergenic
1117766837 14:59092467-59092489 ATGGTCCACAGATGTCAGGCAGG - Intergenic
1118148565 14:63165491-63165513 ATGCTCCTCACATCCCAGACGGG - Intergenic
1118239001 14:64038103-64038125 ATGCTCCTCATCTCCCAGACGGG + Intronic
1118359158 14:65041528-65041550 ATGCTCCCCAAATGACATGACGG - Intronic
1118428691 14:65693004-65693026 ATGCTCCTCACTTTCCAGACTGG + Intronic
1118430917 14:65717689-65717711 ATGCTCCTCACTTCCCAGACGGG + Intronic
1118517755 14:66546072-66546094 GTGCTCCTCACATCCCAGACGGG + Intronic
1119051888 14:71377437-71377459 ATGCTCCTCACTTCCCAGACTGG + Intronic
1119254610 14:73184907-73184929 ATGCTCCTCACCTCCCAGACGGG + Intronic
1119254622 14:73184947-73184969 GTGCTCCTCACATCCCAGACGGG + Intronic
1119700333 14:76750479-76750501 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1119733307 14:76964871-76964893 ATGCTGCTGAAAGGCCAGGTAGG + Intergenic
1119835704 14:77747531-77747553 GTGCTCCTCACATCCCAGACCGG - Intronic
1120087010 14:80286420-80286442 ATGCTCCTCACTTCCCAGACAGG - Intronic
1120170578 14:81244632-81244654 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1120505795 14:85352755-85352777 ATGCTCCTCACTTCCCAGACAGG + Intergenic
1120547678 14:85830226-85830248 ATGCTCCTCACTTCCCAGACTGG + Intergenic
1120609078 14:86618001-86618023 CTGCTCTTCAACTGCCATGCTGG - Intergenic
1120892837 14:89505889-89505911 ACGCTCCTCACATCCCAGACGGG - Intronic
1121531564 14:94658078-94658100 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1121989490 14:98542047-98542069 TTGCTTCTCAAATGCCAGTGTGG - Intergenic
1202848041 14_GL000009v2_random:199851-199873 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1202848059 14_GL000009v2_random:199925-199947 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1202917537 14_GL000194v1_random:190478-190500 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1124132715 15:27004289-27004311 ACGCTCCTCACATCCCAGACGGG + Intronic
1124335096 15:28849943-28849965 ACGCTCCTCACCTTCCAGGCGGG + Intergenic
1125459684 15:39894521-39894543 ATGCTCCTCACCTCCCAGACAGG + Intronic
1125459696 15:39894561-39894583 GTGCTCCTCACATCCCAGACGGG + Intronic
1125566487 15:40682591-40682613 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1125566513 15:40682707-40682729 ACGCTCCTCACATCCCAGACGGG - Intergenic
1125605339 15:40936987-40937009 AGGCTCCTCTTAGGCCAGGCGGG + Intronic
1125651441 15:41320977-41320999 ACGCTCCTCACCTCCCAGGCAGG - Intronic
1125783701 15:42295725-42295747 AAGCTCCTTACATGCCAGACGGG - Intronic
1125862732 15:43014380-43014402 ATGCTCCTCACTTTCCAGACTGG - Intronic
1126125786 15:45293448-45293470 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1126210715 15:46098100-46098122 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1126295339 15:47132404-47132426 GTGCTCCTCACATCCCAGACAGG - Intergenic
1126799391 15:52286047-52286069 ACGCTCCTCACATCCCAGACGGG - Intronic
1127072880 15:55302768-55302790 ATGCTCCTCACCTCCCAGACGGG - Intronic
1127088719 15:55446853-55446875 GTGCTCCTCACATCCCAGACGGG + Intronic
1127088832 15:55447273-55447295 GTGCTCCTCACATCCCAGACTGG + Intronic
1127783001 15:62332632-62332654 GTGCTCCTCACATCCCAGACGGG + Intergenic
1127783037 15:62332788-62332810 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1127824413 15:62690510-62690532 ATGCTCCTCACTTTCCAGACTGG + Intronic
1128436994 15:67662870-67662892 ATGGTCCTCATAAGCCAGTCTGG - Intronic
1128490259 15:68135870-68135892 ATGCTCCTCACCTCCCAGACGGG + Intronic
1128563315 15:68682828-68682850 ATGCTCCCCAAATCCCAGGTGGG + Intronic
1128970110 15:72100614-72100636 GTGCTCCTCACATCCCAGACGGG - Intronic
1128970122 15:72100654-72100676 ATGCTCCTCACCTCCCAGACGGG - Intronic
1129109301 15:73328378-73328400 ATGCTCCTCAAATGCCAGGCTGG + Intronic
1129758572 15:78113355-78113377 AGGCTCAGCAAATGCCAGGGCGG + Intronic
1130942692 15:88524210-88524232 ATGCTCCTCACCTCCCAGACGGG - Intronic
1131043920 15:89297178-89297200 GTGCTCCTCACATCCCAGACGGG + Intronic
1134398760 16:13889530-13889552 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1135639719 16:24109408-24109430 ATGCTCCTCACCTCCCAGACGGG + Intronic
1135639731 16:24109448-24109470 GTGCTCCTCACATCCCAGACGGG + Intronic
1135639787 16:24109680-24109702 ATGCTCCTCACTTCCCAGACGGG + Intronic
1136425714 16:30168746-30168768 GTGCTCCTCACATCCCAGACGGG - Intergenic
1136425726 16:30168786-30168808 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1136593525 16:31232220-31232242 ATGCTCCTCACATCCCAGACGGG - Intergenic
1136668578 16:31836572-31836594 ATGCTCCTCACTTCCCAGGTGGG - Intergenic
1136919075 16:34246207-34246229 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1137283875 16:47000268-47000290 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1137443101 16:48512548-48512570 AAGCTCCTTACTTGCCAGGCTGG - Intergenic
1137493455 16:48951750-48951772 GTGCTCCTCACATCCCAGACGGG - Intergenic
1137493468 16:48951790-48951812 ATGCTCCTCACGTCCCAGACGGG - Intergenic
1138028158 16:53539075-53539097 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1138028257 16:53539468-53539490 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1138043371 16:53698056-53698078 ATGCTCCTCACCTCCCAGACAGG - Intronic
1138467319 16:57201339-57201361 ACGCTCCTCACATCCCAGACGGG + Intronic
1138642637 16:58397227-58397249 ATGCTCCTCACATCCCAGACGGG + Intronic
1139394687 16:66630796-66630818 ATGCTCCTCACTTTCCAGACTGG - Intronic
1139864098 16:70050746-70050768 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1140063213 16:71589261-71589283 ACGCTCCTCACTTGCCAGACGGG - Intergenic
1140993998 16:80242957-80242979 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1140994053 16:80243189-80243211 GTGCTCCTCACATCCCAGACGGG - Intergenic
1140994065 16:80243229-80243251 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1141728738 16:85808239-85808261 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1141728759 16:85808316-85808338 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1142332297 16:89462723-89462745 GTGCTCCTCACATCCCAGACGGG - Intronic
1142533580 17:598615-598637 GTGCTCCTCACATCCCAGACGGG - Intronic
1142533593 17:598655-598677 ATGCTCCTCACCTCCCAGACCGG - Intronic
1142560754 17:807581-807603 GTGCTCCTCAGAAGCCAGGTGGG - Intronic
1142567461 17:849931-849953 CTGCTCCTGAAACCCCAGGCTGG + Intronic
1142634291 17:1247277-1247299 ACGCTCCTCACATCCCAGACGGG + Intergenic
1142634338 17:1247468-1247490 ATGCTCCTCACATCCCAGACGGG + Intergenic
1142705295 17:1689997-1690019 GTGCTCCTCACATCCCAGACGGG + Intergenic
1142705343 17:1690193-1690215 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1142825293 17:2506900-2506922 ATGCTCCTCACATCCCAGACGGG - Intronic
1142913142 17:3112599-3112621 ACGCTCCTCACATCCCAGACGGG + Intergenic
1142939926 17:3372165-3372187 GTGCTCCTCACATCCCAGACGGG + Intergenic
1143342710 17:6226086-6226108 ACGCTCCTCATATCCCAGACGGG - Intergenic
1143667719 17:8373943-8373965 ATGCTCCTCACTTCCCAGACGGG - Intronic
1143689626 17:8550342-8550364 GTGCTCCTCACATCCCAGACGGG - Intronic
1143689640 17:8550382-8550404 ATGCTCCTCACCTCCCAGACGGG - Intronic
1143718410 17:8792853-8792875 ATGGTGCTTAAATGCAAGGCTGG - Intergenic
1144275691 17:13666384-13666406 GTGCTCCTCACATCCCAGACAGG + Intergenic
1144509941 17:15867207-15867229 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1144509957 17:15867283-15867305 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1144536344 17:16095219-16095241 GTGCTCCTCACATCCCAGACGGG - Intronic
1144860383 17:18298077-18298099 ACGCTCCTCACATCCCAGACGGG - Intronic
1144866345 17:18338186-18338208 GTGCTCCTCACATCCCAGACGGG - Intronic
1144866377 17:18338303-18338325 ATGCTCCTCACTTCCCAGACGGG - Intronic
1145022254 17:19441514-19441536 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1145027049 17:19475973-19475995 ACGCTCCTCACATCCCAGACGGG - Intergenic
1145056564 17:19707232-19707254 CTGTTCCTGAAATGCCTGGCAGG + Intronic
1145174046 17:20684826-20684848 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1145418101 17:22741204-22741226 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1145684209 17:26638195-26638217 GTGCTCCTCACATCCCAGACGGG - Intergenic
1145717120 17:27033611-27033633 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1145717167 17:27033807-27033829 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1145862747 17:28223564-28223586 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1145872186 17:28283893-28283915 TTCCACCACAAATGCCAGGCTGG + Intergenic
1145896163 17:28459034-28459056 ACGCTCCTCAATTCCCAGACGGG - Intronic
1145927648 17:28659658-28659680 ACGCTCCTCACATCCCAGACAGG + Intronic
1146048867 17:29533062-29533084 ATGCTCCTCACTTCCCAGACGGG + Intronic
1146731381 17:35195587-35195609 ACGCTCCTCACTTCCCAGGCGGG + Intergenic
1147172559 17:38630805-38630827 ACGCTCCTCACATCCCAGACGGG - Intergenic
1147809726 17:43159573-43159595 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1147974135 17:44238027-44238049 GTGCTCCTCACATCCCAGACGGG - Intergenic
1148269578 17:46252972-46252994 ACGCTCCTCAATTCCCAGACGGG + Intergenic
1148299570 17:46534986-46535008 ATGCTCCTCACCTCCCAGACAGG + Intronic
1148404232 17:47397666-47397688 GCGCTCCTCACATCCCAGGCGGG - Intronic
1148406391 17:47420445-47420467 ATGCTCCTCACTTTCCAGACTGG - Intronic
1148632817 17:49125566-49125588 ATGCTCCTCACCTCCCAGACCGG - Intergenic
1148672287 17:49419904-49419926 GTGCTCCTCACCTCCCAGGCGGG + Intronic
1149625149 17:58074594-58074616 ATGCTCCTCACATCCCGGACGGG + Intergenic
1149632985 17:58142443-58142465 GTGCTCCTCACATCCCAGACGGG - Intergenic
1149645733 17:58240250-58240272 TTGCCCCTCAAATGCCAGGCTGG - Intronic
1149793631 17:59500261-59500283 GTGCTCCTCACATCCCAGACGGG - Intergenic
1150477204 17:65484437-65484459 ACGCTCCTCACATCCCAGACGGG - Intergenic
1150477236 17:65484554-65484576 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1150527262 17:65937275-65937297 ATGCTCCTCACTTTCCAGACTGG - Intronic
1150894622 17:69196235-69196257 ATGCTCCTCACTTCCCAGACGGG + Intronic
1153221732 18:2868026-2868048 ATGCTCCTCACTTCCCAGACGGG + Intronic
1153634035 18:7098503-7098525 GTGCTCCTCACATCCCAGACGGG - Intronic
1153634046 18:7098543-7098565 ATGCTCCTCACCTCCCAGACGGG - Intronic
1153646883 18:7203772-7203794 ACGCTCCTCACATCCCAGACGGG + Intergenic
1153819892 18:8824201-8824223 ATGCCTCTCACATGCCTGGCAGG - Intronic
1154089630 18:11344808-11344830 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1154115878 18:11613221-11613243 ACGCTCCTCACATCCCAGACGGG - Intergenic
1154278662 18:12980965-12980987 ATGCTCCTCACTTCCCAGACGGG + Intronic
1154420359 18:14223359-14223381 ACGCTCCTCACCTTCCAGGCGGG - Intergenic
1154420443 18:14223661-14223683 ACGCTCCTCACATCCCAGACAGG - Intergenic
1154420733 18:14224637-14224659 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1154483230 18:14856436-14856458 GCGCTCCTCAACTGCCAGACCGG + Intergenic
1155177481 18:23313583-23313605 ATGCTCTTCAAGGGCTAGGCAGG - Intronic
1155238244 18:23842774-23842796 TTGCTCCTCACATGCCTGCCTGG + Intronic
1156326308 18:36077755-36077777 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1156326377 18:36077992-36078014 GTGCTCCTCACATCCCAGACGGG + Intergenic
1156326431 18:36078224-36078246 ATGCTCCTCACTTCCCAGACAGG + Intergenic
1156644815 18:39148192-39148214 ATACTCCTCCAATGCTGGGCTGG - Intergenic
1157195292 18:45615922-45615944 ATGCTCCTAAGAGGCCAGGAAGG + Intronic
1157455819 18:47827902-47827924 ATGCTCCTCACTTCCCAGACGGG - Exonic
1158459384 18:57633253-57633275 ATGCTCCTCACATCCCGGACGGG + Intergenic
1158646891 18:59255673-59255695 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1159596124 18:70384315-70384337 ATTCTCCTCACATGCAAAGCAGG - Intergenic
1159614931 18:70569847-70569869 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1159963166 18:74571588-74571610 GTGCTCCTAGAATGCCGGGCCGG + Intronic
1160465479 18:79072894-79072916 ATGCTCCTCACCTCCCAGACAGG + Intronic
1160916668 19:1499822-1499844 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1160948448 19:1654357-1654379 ATGCTGCACCTATGCCAGGCCGG + Intergenic
1161365520 19:3877143-3877165 TTGCTCTTTAAATGCCAGTCTGG + Intergenic
1161422186 19:4182128-4182150 ACGGGGCTCAAATGCCAGGCTGG - Intronic
1162163868 19:8739509-8739531 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1162278904 19:9679839-9679861 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1162278993 19:9680192-9680214 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1162695069 19:12467875-12467897 ATGCTCCTCACTTCCCAGACAGG - Intronic
1162935690 19:13980428-13980450 ATGCTTATCAAAGGCCAGGGTGG + Intronic
1163542240 19:17918409-17918431 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1163568155 19:18064049-18064071 TTACTCCTCAGAGGCCAGGCTGG + Intronic
1163896534 19:20064746-20064768 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1163921766 19:20296495-20296517 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1163945542 19:20530609-20530631 GTGCTCCTCACATCCCAGACGGG + Intergenic
1163945589 19:20530801-20530823 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1164012223 19:21213014-21213036 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1164016684 19:21260622-21260644 ATGCTCCTCACCTCCCAGACAGG + Intronic
1164016835 19:21261235-21261257 ATGCTCCTCACCTCCCAGACAGG + Intronic
1164034772 19:21443660-21443682 ACGCTCCTCACTTCCCAGGCGGG + Intronic
1164054952 19:21614713-21614735 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1164071770 19:21775692-21775714 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1164126298 19:22321853-22321875 ATGCTCCTCACTTCCTAGGCGGG + Intergenic
1164218622 19:23173179-23173201 ATGCTCCTCACATCCCAGACGGG - Intergenic
1164231237 19:23290230-23290252 GTGCTCCTCACATCCCAGACGGG + Intergenic
1164256672 19:23533715-23533737 ATGCTCCTCACCTCCCAGACGGG + Intronic
1164263865 19:23594657-23594679 ATGCTCCTCACTTTCCAGACTGG - Intronic
1164298571 19:23937642-23937664 ATGCTCCTCACTTTCCAGACTGG + Intronic
1165582486 19:36879684-36879706 ATGCTGCTCAAAGGAAAGGCCGG - Intronic
1165852161 19:38855867-38855889 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1166115092 19:40648550-40648572 ACGCTCCTCACATCCCAGACGGG + Intergenic
1166115118 19:40648666-40648688 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1166418038 19:42610535-42610557 ATGCTCCTCACTTCCCAGACGGG + Intronic
1166418059 19:42610612-42610634 ATGCTCCTCACGTCCCAGACGGG + Intronic
1166611714 19:44204140-44204162 ATGCTCCTCACTTCCCAGACAGG - Intergenic
1166640171 19:44488842-44488864 ATGCTCCTCACCTCCCAGACGGG - Intronic
1166832685 19:45648091-45648113 ACGCTCCTCACATCCCAGACGGG - Intergenic
1167038772 19:47009773-47009795 GTGCTCCTCACATCCCAGACGGG - Intergenic
1167038784 19:47009813-47009835 ATGCTCCTCACCTCCCAGACCGG - Intergenic
1167588787 19:50391271-50391293 ATGCTCCTCACTTCCCAGACGGG + Intronic
1167688636 19:50971541-50971563 AAGGTCCTCAAATGCCAGGCTGG - Intergenic
1167897555 19:52593739-52593761 ACGCTCCTCACATCCCAGACGGG + Intergenic
1167897763 19:52594812-52594834 ATGCTCCTCAAAAACCAGAACGG - Intronic
1167899704 19:52610582-52610604 ATGCTCCTCAAAAACCAGAATGG - Intronic
1167908144 19:52679307-52679329 ATGCTCCTCAAAAACCAGAATGG + Intronic
1168189124 19:54725331-54725353 ATGCTCCTGAAACGGGAGGCAGG + Intronic
1168658215 19:58146973-58146995 ATGCTCCTCACTTCCCAGACAGG - Intronic
1168696227 19:58405530-58405552 ATGCTCCTCACTTCCCAGACGGG + Intronic
925400561 2:3569493-3569515 ATGCTCCTCACTTTCCAGACTGG + Intergenic
925407564 2:3615943-3615965 ATGCTCCTCACTTCCCAGACGGG + Intronic
925651691 2:6097096-6097118 ATGCACCTAAGATGCCAGTCAGG + Intergenic
926167509 2:10530728-10530750 ATGATGCTCAGATGCCAGTCAGG + Intergenic
926215541 2:10903093-10903115 GTGCTCCTCACATCCCAGACGGG + Intergenic
927777079 2:25910948-25910970 GCGCTCCTCACATCCCAGGCGGG + Intergenic
927833357 2:26371201-26371223 ATGCTCCTCACTTCCCAGACGGG + Intronic
928248541 2:29653632-29653654 ATGCTCAATAAATGTCAGGCAGG + Intronic
928585546 2:32754922-32754944 ATGCTCCTCACTTCCCAGACGGG + Intronic
928585597 2:32755119-32755141 ATGCTCCTCACTTTCCAGACTGG + Intronic
928722203 2:34133304-34133326 GTGCTCCTCACATCCCAGACGGG + Intergenic
929343578 2:40853317-40853339 ATGCTTCCCAAACTCCAGGCGGG + Intergenic
929445169 2:41995546-41995568 ACGCTCCTCACATCCCAGACGGG - Intergenic
929650864 2:43678207-43678229 ATGCTCCTCACTTTCCAGACTGG + Intronic
929689335 2:44061572-44061594 GTGCTCCTCACTTCCCAGGCAGG + Intergenic
929739486 2:44588092-44588114 GTGCTCCTCACATCCCAGACAGG - Intronic
929791599 2:45027251-45027273 ATGCTTCTCAGATGGCAGGCTGG - Intergenic
930079420 2:47433907-47433929 ACGCTCCTCACATCCCAGACGGG + Intronic
930079463 2:47434099-47434121 ATGCTCCTCACTTCCCAGACGGG + Intronic
930665664 2:54096406-54096428 ATGCTCCTCACTTCCCAGACGGG + Intronic
931576376 2:63722383-63722405 GTGCTCCTCACATCCCAGACGGG - Intronic
931584219 2:63808996-63809018 GTGCTCCTCACATCCCAGACGGG - Intronic
931783764 2:65601223-65601245 ACGCTCCTCACATCCCAGACGGG + Intergenic
932042993 2:68319559-68319581 CTGCTCCTCAAAAGCCCGGGCGG - Exonic
932367175 2:71160876-71160898 ATGCTCCTCACTTCCCAGACGGG - Intergenic
932710890 2:74061918-74061940 ATGCTCCTCACTTTCCAGACTGG + Intronic
933734927 2:85487678-85487700 ACGCTCCTCACATCCCAGACGGG - Intergenic
935636128 2:105251076-105251098 ATGCTCCTCACTTTCCAGACGGG - Intergenic
936345546 2:111672498-111672520 ATGCTCCTCACTTCCCAGACAGG - Intergenic
937066661 2:119022954-119022976 ATGCTCCACAAATGCCACCTGGG - Intergenic
938533793 2:132221133-132221155 ATGCTCCTCACTTCCCAGACGGG - Intronic
938829124 2:135034076-135034098 ATGCTCCTCACCTCCCAGACGGG + Intronic
938836188 2:135105846-135105868 GTGCTCCTCACATCCCAGACGGG - Intronic
939477258 2:142702572-142702594 ATGCTCCTCACTTCCCAGACGGG - Intergenic
940004196 2:148996611-148996633 GTGCTCCCTAAATGCCAGCCAGG - Intronic
940299115 2:152160383-152160405 ACGCTCCTCACATCCCAGACGGG - Intronic
940372273 2:152916736-152916758 AAGCTCCTTACATGCTAGGCTGG + Intergenic
940757544 2:157699898-157699920 ATGCTACTCTCATGCCATGCTGG + Intergenic
941793389 2:169575587-169575609 GTGCTCCTCACATCCCAGACGGG + Intergenic
941822341 2:169856016-169856038 ACGCTCCTCACCTGCCAGACGGG + Intronic
942012165 2:171774684-171774706 GTGCTCCTCACATCCCAGACGGG - Intergenic
942489763 2:176477432-176477454 ATGTGCCTCAGAGGCCAGGCAGG - Intergenic
942519706 2:176790796-176790818 ATCCTCCACCCATGCCAGGCTGG + Intergenic
943100281 2:183479048-183479070 ATGCTCCTCACTTCCCAGACGGG - Intergenic
943125850 2:183792651-183792673 ATGCTCCTCACATCCCACACCGG + Intergenic
943323415 2:186472903-186472925 GTGCTCCTCACATCCCAGACAGG - Intergenic
943411634 2:187556322-187556344 ACGCTCCTCACTTCCCAGGCGGG - Intronic
944283644 2:197923731-197923753 ATGCTCCTCACTTCCCAGACGGG + Intronic
944533087 2:200684096-200684118 ACGCTCCTCACATCCCAGACAGG + Intergenic
944585175 2:201166461-201166483 AAGCTCCTCACATCCCAGACGGG + Exonic
945530811 2:210950872-210950894 ATGCTCCTCACTTCCCAGACGGG - Intergenic
946650977 2:221892308-221892330 ATGCTCCTCACTTCCCAGACGGG - Intergenic
946805928 2:223471317-223471339 TTGCTCCTCCAGTGCTAGGCAGG - Intergenic
948000422 2:234562820-234562842 ACGCTCCTCACATCCCAGACAGG - Intergenic
1169108898 20:3019455-3019477 ATGCTCCTCACATCCCGGACGGG + Intronic
1169125531 20:3124698-3124720 ACGCTCCTCACATCCCAGACAGG - Intronic
1169125551 20:3124775-3124797 ACGCTCCTCACATCCCAGACGGG - Intronic
1169441796 20:5639382-5639404 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1169984634 20:11430285-11430307 TTTCTTCTCAAATACCAGGCAGG + Intergenic
1169991988 20:11513763-11513785 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1171848552 20:30292149-30292171 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1171899898 20:30847163-30847185 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1171899937 20:30847320-30847342 GCGCTCCTCAAATCCCAGACGGG + Intergenic
1171899978 20:30847512-30847534 ATGCTCCTCACTTCCCAGACAGG + Intergenic
1172051618 20:32122350-32122372 ATGCTCCTCACTTCCCAGACGGG + Intronic
1172051714 20:32122742-32122764 ATGCTCCTCACTTCCCAGACGGG + Intronic
1172209246 20:33185536-33185558 GTGCTCCTCACATACCAGCCGGG + Intergenic
1172209285 20:33185692-33185714 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1172237634 20:33389046-33389068 ATGCTCCTCACTTCCCAGACGGG - Intronic
1172337861 20:34132459-34132481 GTGCTCCTCACATCCCAGACGGG - Intergenic
1172379266 20:34474957-34474979 ATGCTCCTCACCTCCCAGACGGG + Intronic
1172401867 20:34658415-34658437 ATGCTCCTCACTTCCCAGACGGG - Intronic
1172401975 20:34658844-34658866 ATGCTCCTCACTTCCCAGACGGG - Intronic
1172720930 20:37000106-37000128 ACGCTCCTCACATCCCAGACGGG - Intronic
1172722716 20:37012362-37012384 ATGCTCCTCATTTTCCAGACTGG - Intronic
1172728856 20:37069492-37069514 GTGCTCCTCACATCCCAGACGGG - Intronic
1172728867 20:37069532-37069554 ATGCTCCTCACCTCCCAGACGGG - Intronic
1172808655 20:37631735-37631757 AAGGTCCTCATGTGCCAGGCAGG + Intergenic
1172910701 20:38407260-38407282 ACGCTCCTCAATTCCCAGACAGG - Intergenic
1172910776 20:38407572-38407594 ACGCTCCTCAATTCCCAGACGGG - Intergenic
1172914857 20:38435943-38435965 AGGTTCCTCAGATGCCAGTCTGG - Intergenic
1173473058 20:43338487-43338509 ACGCTCCTCACATCCCAGACGGG + Intergenic
1174020738 20:47526334-47526356 ATGCTCCTCACTTCCCAGACGGG + Intronic
1174218857 20:48936394-48936416 ATGCTCCTCACTTCCCAGACGGG + Intronic
1174344774 20:49921872-49921894 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1174344870 20:49922261-49922283 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1174484541 20:50852889-50852911 AGGAGACTCAAATGCCAGGCTGG - Intronic
1174835797 20:53854424-53854446 ACGCTCCTCACATCCCAGACGGG - Intergenic
1175361467 20:58414526-58414548 ATGCTCCTCACCTCCCAGACGGG + Intronic
1176797276 21:13379715-13379737 GCGCTCCTCAACTGCCAGACTGG - Intergenic
1176797324 21:13379903-13379925 GTGCTCCTCACTTCCCAGGCGGG - Intergenic
1177788291 21:25695647-25695669 ATGCTCCTCACTTCCCAGACGGG + Intronic
1177862552 21:26471282-26471304 ATGCTCCTCAAGTGGGAGGCAGG - Intronic
1178034407 21:28564061-28564083 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1179413601 21:41180435-41180457 TTACTCCTCCAGTGCCAGGCAGG - Intronic
1179969086 21:44824504-44824526 ACGCTCCTCAATTCCCAGACGGG - Intergenic
1180039422 21:45268481-45268503 ATGCTCCTCACTTTCCAGACTGG - Intronic
1180125050 21:45785075-45785097 ATGCTCCTCACATCCCGGACGGG - Intronic
1180125092 21:45785232-45785254 ATGCTCCTCACTTCCCAGACGGG - Intronic
1180739352 22:18041923-18041945 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1181274022 22:21677270-21677292 ACGCTCCTCACATCCCAGACAGG + Intronic
1181658011 22:24317706-24317728 ATGCTCCTCACTTCCCAGACGGG + Intronic
1181792306 22:25277809-25277831 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1182331100 22:29552399-29552421 GTGCTCCTCACATCCCAGACGGG - Intronic
1182343646 22:29644222-29644244 ATGCTCCTCACCTCCCAGACGGG + Intronic
1182976340 22:34626316-34626338 ATGCTCCTCACATCCCAGATGGG + Intergenic
1183185764 22:36290841-36290863 ATGCTCCTCACCTCCCAGACGGG - Intronic
1183377623 22:37474244-37474266 CTGGTCCTCAAATGCCGGGAAGG - Intronic
1183988101 22:41580347-41580369 ATGCTCCTCCAGTGCCAGAAGGG + Intronic
1184049638 22:41994855-41994877 ATGCTCCACAAATACCAGACAGG - Intronic
1184201328 22:42971702-42971724 ATGCTCCTCACTTCCCAGACAGG - Intronic
1185364274 22:50429437-50429459 TTGCTCCTCAAATGCAAGGATGG - Intronic
949570020 3:5284065-5284087 GTGCTCCTCACATCCCAGACGGG + Intergenic
949989859 3:9569987-9570009 ATGCTCCTCAATTCCTAGACGGG - Intergenic
949989879 3:9570063-9570085 ACGCTCCTCACATCCCAGACGGG - Intergenic
950742330 3:15061714-15061736 ACGCTCCTCACTTTCCAGGCTGG - Intronic
950742362 3:15061830-15061852 ATGCTCCTCACCTCCCAGACGGG - Intronic
950819527 3:15742548-15742570 ATGCTCCTCACTTCCCAGACGGG - Intronic
951550557 3:23871714-23871736 GTGCTCCTCACATCCCAGACGGG + Intronic
952308812 3:32169589-32169611 ATGCTCCTCACTTTCCAGACGGG - Intergenic
952892607 3:38053444-38053466 ATGCTCCTCACCTCCCAGACGGG - Intronic
953257551 3:41305874-41305896 GTGCTCCTCACATCCCAGACGGG - Intronic
953257562 3:41305914-41305936 ATGCTCCTCACCTCCCAGACGGG - Intronic
953966253 3:47309497-47309519 ATGCTCCTCACTTCCCAGACTGG + Intronic
954048378 3:47952201-47952223 ATGCTCCTCACTTCCCAGACGGG - Intronic
954529819 3:51308965-51308987 GTGCTCCTCACATCCCAGACGGG + Intronic
955173077 3:56584473-56584495 GTGCTCCTCACATCCCAGACGGG + Intronic
955173125 3:56584665-56584687 ACGCTCCTCACTTCCCAGGCAGG + Intronic
955256625 3:57338595-57338617 ATGCTCTTCACATCCCAGACGGG - Intronic
955674579 3:61435030-61435052 ATGCTCCTCACCTCCCAGACGGG + Intergenic
955674592 3:61435070-61435092 GTGCTCCTCACATCCCAGACGGG + Intergenic
955699806 3:61671944-61671966 ATGCTCCTCACTTCCCAGACGGG + Intronic
956270304 3:67443745-67443767 ATGCTCCTCACCTCCCAGACGGG - Intronic
957789253 3:84918724-84918746 ACGCTCCTCACATCCCAGACGGG - Intergenic
958407030 3:93763984-93764006 ATGCTCCCCACATCCCAGACGGG + Intergenic
958431373 3:94044347-94044369 ACGCTCCTCACATCCCAGACGGG - Intronic
958957522 3:100478321-100478343 ATGCTCCTCACTTTCCAGACTGG + Intergenic
958957559 3:100478477-100478499 ATGCTCCTCACTTTCCAGACTGG + Intergenic
959201775 3:103255398-103255420 ATGCTCCTCACTTTCCAGACTGG + Intergenic
960388585 3:117050584-117050606 ACGCTCCTCACATCCCAGACGGG - Intronic
960526690 3:118718571-118718593 ATGCTCCTCACTTCCCAGACGGG + Intergenic
960770791 3:121190841-121190863 ATGCTCCTCACCTCCCAGACGGG + Intronic
960817525 3:121688840-121688862 ATGCTCCTCACCTCCCAGACGGG - Intronic
960920927 3:122747151-122747173 ATGCTCCTCACTTTCCAGACTGG - Intronic
961962380 3:130867945-130867967 ACGCTCCTCACATCCCAGACAGG - Intronic
962342461 3:134596925-134596947 CTGATCCACAAAGGCCAGGCAGG + Intergenic
962572142 3:136723346-136723368 GTGCTCCTCACATCCCAGACGGG - Intronic
962623127 3:137198777-137198799 ATGCTCCTCACTTTCCAGACTGG + Intergenic
962761829 3:138521575-138521597 ATGCTCCTCACCTCCCAGACAGG - Intronic
963776414 3:149445122-149445144 ATGCTCCTCACCTCCCAGACAGG + Intergenic
965136926 3:164784550-164784572 GTGCTCCTCACATCCCAGACGGG - Intergenic
965302293 3:167018642-167018664 ATGCTCCTCACTTCCCAGACGGG - Intergenic
965650027 3:170923611-170923633 GTGCTCCTCACATCCCAGACGGG - Intergenic
966015615 3:175133295-175133317 ATGCTCCTCACTTCCCAGACGGG + Intronic
966351067 3:179032932-179032954 AGGCTCCTCAATTCCCAGACGGG - Intronic
966617169 3:181925854-181925876 AGGCTCCTCAATTCCCAGACGGG + Intergenic
966636905 3:182145111-182145133 AAGGTCCTCAAATGCCCAGCTGG - Intergenic
967127254 3:186435502-186435524 ATGCTCCTCACCTCCCAGACGGG + Intergenic
967524219 3:190473276-190473298 ACGCTCCTCACATCCCAGACGGG - Intergenic
968139439 3:196244228-196244250 ACGCTCCTCACATCCCAGACGGG - Intronic
968253037 3:197240059-197240081 ATGCATCTCAAATGCCAGAAGGG + Intronic
968299551 3:197602457-197602479 ACGCTCCTCACTTGCCAGACGGG + Intergenic
968411569 4:395412-395434 ATGCTCCTCACTTCCCAGACGGG - Intergenic
968429836 4:550517-550539 ACGCTCCTCACATCCCAGACAGG + Intergenic
968429881 4:550713-550735 ATGCTCCTCACTTTCCAGACTGG + Intergenic
968507129 4:975998-976020 GTGCTCCTCACATCCCAGACAGG - Intronic
968680067 4:1911886-1911908 ATGCTCCTTACATGTCAGGTGGG - Intronic
968924344 4:3539090-3539112 ACGCTCCTCACATCCCAGACAGG + Intergenic
968924371 4:3539206-3539228 ACGCTCCTCACTTTCCAGGCTGG + Intergenic
969404162 4:6977895-6977917 ACGCTCCTCACATCCCAGACGGG - Intronic
970216128 4:13761426-13761448 GTGCTCCTCACATCCCAGACGGG + Intergenic
972242334 4:37206642-37206664 ATACTTATTAAATGCCAGGCAGG + Intergenic
972288214 4:37668714-37668736 ATGCTCCTCACTTTCCAGACTGG - Intronic
972304654 4:37820253-37820275 ATGCTCCTCACTTCCCAGACGGG - Intergenic
972412350 4:38807338-38807360 ATGCTCCTCACTTTCCAGACTGG - Intronic
972938410 4:44167844-44167866 ATGCTCCTCACCTCCCAGACGGG - Intergenic
973021333 4:45208092-45208114 ATGCTCCTCACCTCCCAGACGGG - Intergenic
973109027 4:46377233-46377255 ATGCTCCTCACTTTCCAGACTGG - Intronic
973650380 4:52992525-52992547 GTGCTCCTCACTTGCCAGACTGG - Intronic
973673193 4:53238662-53238684 ATGCTCCTCACCTCCCAGACGGG + Intronic
973673205 4:53238702-53238724 GTGCTCCTCACATCCCAGACGGG + Intronic
973673261 4:53238934-53238956 ATGCTCCTCACTTCCCAGACGGG + Intronic
973785043 4:54325666-54325688 ATGCTCCTCACTTCCCAGACGGG + Intergenic
975042394 4:69761857-69761879 ATGCTCCTCACTTTCCAGACTGG - Intronic
975633435 4:76423392-76423414 ATGCTCCTCACCTCCCAGACGGG - Intergenic
975908781 4:79245357-79245379 ATGCTCCTCATCTCCCAGACAGG - Intronic
976511907 4:85921130-85921152 ATGCCCATCAAATGACAGACTGG + Intronic
977205088 4:94157928-94157950 GTGCTCCTCACATCCCAGACGGG - Intergenic
977205098 4:94157968-94157990 ATGCTCCTCACTTCCCAGACGGG - Intergenic
978093713 4:104749443-104749465 ATGCTCCTAAAATTTCTGGCTGG - Intergenic
978630331 4:110736662-110736684 ATGCATGTCAAATGCCATGCTGG + Intergenic
978820276 4:112957896-112957918 ATGCTCCTCACCTCCCAGACGGG + Intronic
978947468 4:114516400-114516422 ATGCTCCTCACTTTCCAGACTGG - Intergenic
978947504 4:114516556-114516578 GTGCTCCTCACATCCCAGACGGG - Intergenic
979482856 4:121238597-121238619 ACGCTCCTCACATCCCAGACGGG - Intergenic
979641661 4:123016463-123016485 GTGCTCCTCACATCCCAGACGGG + Intronic
979702501 4:123684971-123684993 ATGCTCCTCACCTCCCAGACGGG - Intergenic
980056608 4:128084197-128084219 ATGCTCCTCACTTCCCAGACGGG + Intronic
980895172 4:138854281-138854303 ATGCTCCTCACTTCCCAGACGGG - Intergenic
981491292 4:145343123-145343145 AAGCTCCTTACATGCCAGACAGG - Intergenic
981677390 4:147357698-147357720 ATGCTCCTCACTTCCCAGACGGG - Intergenic
981877081 4:149559628-149559650 ATGCTCTTCACACACCAGGCAGG + Intergenic
981993691 4:150954093-150954115 ATGCTCCTCACTTCCCAGACGGG - Intronic
982026182 4:151255328-151255350 ATGCTCCTCACCTCCCAGACAGG + Intronic
982026194 4:151255368-151255390 GTGCTCCTCACATCCCAGACGGG + Intronic
982075226 4:151731537-151731559 ATGCTCCTCACTTCCCAGACGGG - Intronic
982075270 4:151731729-151731751 ACGCTCCTCACATCCCAGACGGG - Intronic
982709751 4:158746858-158746880 ATGCTCCTCACCTCCCAGACGGG + Intergenic
982820998 4:159940152-159940174 ATGCTCCTCACTTTCCAGACTGG + Intergenic
983652195 4:170046368-170046390 ATGCTCCTCACATCCCGGACCGG - Intergenic
984004980 4:174295328-174295350 GTGCTCCTCACATCCCAGACGGG + Intronic
984977240 4:185240859-185240881 ACGCTCCTCACATCCCAGACGGG + Intronic
985736405 5:1586064-1586086 ATGCTCCTCACATCCCGGACGGG - Intergenic
987268033 5:16277201-16277223 GTGCTCCTCACATCCCAGACGGG + Intergenic
987367258 5:17160033-17160055 ATCCTCATCAAATGCAAGCCAGG - Intronic
987469231 5:18309482-18309504 ATGCTCCTCACTTTCCAGACTGG - Intergenic
988532840 5:32040898-32040920 GTGCTCCTCACATCCCAGACAGG - Intronic
988532961 5:32041276-32041298 ATGCTCCTCACTTCCCAGACGGG - Intronic
988544300 5:32142258-32142280 ATGCTCCTCACATCCCGGACGGG - Intronic
989021580 5:37013705-37013727 ATGCTCCTCACTTTCCAGACTGG + Intronic
989021597 5:37013781-37013803 ATGCTCCTCACTTCCCAGACGGG + Intronic
989048383 5:37295545-37295567 ATGCTCCTCACTTTCCAGACTGG - Intronic
989076054 5:37563907-37563929 ACGCTCCTCACATCCCAGACGGG + Intronic
989208831 5:38839352-38839374 AAGCTTAGCAAATGCCAGGCAGG + Intergenic
989211603 5:38862581-38862603 ATGCTCCTCACCTCCCAGACCGG + Intronic
989574956 5:42980255-42980277 ACGCTCCTCAATTCCCAGACGGG - Intergenic
989640488 5:43578490-43578512 GCGCTCCTCACATCCCAGGCGGG + Intergenic
989640524 5:43578646-43578668 ATGCTCCTCACTTTCCAGACTGG + Intergenic
989655893 5:43746160-43746182 ATGCTCCTCACTTCCCAGACAGG + Intergenic
989655965 5:43746472-43746494 ATGCTCCTCACTTCCCAGACTGG + Intergenic
990293820 5:54381203-54381225 ACGCTCCTCACATCCCAGACGGG - Intergenic
990498530 5:56372433-56372455 ATGCTCCTCACTTTCCAGACTGG - Intergenic
990501174 5:56398229-56398251 ATGCTCCTCACTTCCCAGACGGG + Intergenic
991127430 5:63084124-63084146 ATGCTCCTCACTTTCCAGACTGG + Intergenic
991373256 5:65940358-65940380 ATGCTCCTCACTTCCCAGACGGG - Intronic
991377029 5:65977341-65977363 ATGCTCCTCACTTCCCAGACGGG + Intronic
991542461 5:67745190-67745212 AAGCTCCTTACATGCCAGACTGG - Intergenic
991935359 5:71794607-71794629 ATGCTCCTCACCTTCCAGACGGG + Intergenic
992964252 5:81983844-81983866 ACGCTCCTCACATCCCAGACGGG + Intronic
994907444 5:105859416-105859438 GTGCTCCTCACATCCCAGACGGG - Intergenic
994909438 5:105883623-105883645 ATGCTCCTCAAATTACAGTAGGG + Intergenic
995140101 5:108726673-108726695 ATGGTTCTCAAATGCCTGGCTGG + Intergenic
995193273 5:109341334-109341356 ATGCTCCTCACCTCCCAGACGGG - Intronic
995614421 5:113944798-113944820 TTGATCTTGAAATGCCAGGCTGG - Intergenic
995796461 5:115946327-115946349 CTGCTACTGTAATGCCAGGCGGG - Intergenic
996054042 5:118964862-118964884 ATGCTCCTCACTTCCCAGACGGG - Intronic
996054090 5:118965054-118965076 GTGCTCCTCACATCCCAGACGGG - Intronic
996070055 5:119122487-119122509 ATGCTCCTCACTTCCCAGACGGG + Intronic
996070134 5:119122801-119122823 ATGCTCCTCACTTTCCAGACTGG + Intronic
996218205 5:120894019-120894041 AAGCTCCTTACATGCCAGACTGG + Intergenic
997565367 5:134882340-134882362 ATGCTCCTCACTTTCCAGACTGG + Intronic
998053606 5:139056325-139056347 ATGCTCCTCACCTCCCAGACGGG - Intronic
998910254 5:146952024-146952046 ATGATCCTCTAATGCCAGGGTGG - Intronic
999532632 5:152479994-152480016 ATGCTCCTCACTTCCCAGACAGG + Intergenic
999604199 5:153297083-153297105 ATGCTCCTCACCTCCCAGACAGG + Intergenic
999604210 5:153297123-153297145 ATGCTCCTCACATCCCAGACGGG + Intergenic
999979043 5:156940607-156940629 ATGCTCCTCACCTCCCAGACGGG - Intronic
999986923 5:157013965-157013987 ATGCTCCTCACTTCCCAGACAGG - Intergenic
999987016 5:157014314-157014336 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1000032881 5:157419447-157419469 ATGCTCCTCACTTTCCAGACTGG - Intronic
1000159068 5:158582220-158582242 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1002031484 5:176433620-176433642 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1003407459 6:5835992-5836014 ACGCTCCTCACATCCCAGACGGG + Intergenic
1004448852 6:15726658-15726680 ACGCTCCTCACATCCCAGACGGG + Intergenic
1004874283 6:19939198-19939220 ACGCTCCTCAATTTCCAGACTGG - Intergenic
1005063626 6:21797712-21797734 ATGCTCCTCACATCCCAGACGGG + Intergenic
1005158680 6:22836232-22836254 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1005865273 6:29932523-29932545 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1005901698 6:30222122-30222144 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1006014160 6:31067276-31067298 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1006065084 6:31455687-31455709 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1006281893 6:33059977-33059999 ACGCTCCTCAATTCCCAGACAGG + Intergenic
1006492172 6:34397158-34397180 ATGCTCCTCACTTTCCAGACTGG - Intronic
1006623525 6:35383683-35383705 GTGCTCCTCACATCCCAGACGGG - Intronic
1006623537 6:35383723-35383745 ATGCTCCTCACCTCCCAGACGGG - Intronic
1006826771 6:36941443-36941465 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1009048999 6:58257546-58257568 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1009217876 6:60944992-60945014 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1009392730 6:63163884-63163906 ACGCTCCTCACATCCCAGACGGG - Intergenic
1009844828 6:69121990-69122012 ATGCTCCTCACTTCCCAGACAGG + Intronic
1010030529 6:71266776-71266798 ACGCTCCTCACATCCCAGACGGG + Intergenic
1010245962 6:73660842-73660864 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1010246013 6:73661039-73661061 GTGCTCCTCACATCCCAGACGGG + Intergenic
1010264466 6:73851352-73851374 GTGCTCCTCACATCCCAGACGGG + Intergenic
1010270903 6:73915079-73915101 ATGCTCCTCACCTCCCAGACAGG + Intergenic
1010513118 6:76744308-76744330 GTGCTCCTCACATCCCAGACGGG - Intergenic
1010513129 6:76744348-76744370 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1010513170 6:76744505-76744527 ATGCTCCTCACTTCCCAGACTGG - Intergenic
1010866554 6:80982931-80982953 TTACTCCTCCAATGCTAGGCAGG + Intergenic
1011297166 6:85838408-85838430 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1012428666 6:99142031-99142053 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1012479415 6:99650412-99650434 ACGCTCCTCACATCCCAGACGGG + Intergenic
1012983684 6:105854088-105854110 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1012983702 6:105854165-105854187 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1013372045 6:109479384-109479406 ATGATCCTCTCATGCCATGCCGG - Intronic
1013638021 6:112047531-112047553 ATGCTCCTCACTTTCCAGACGGG - Intergenic
1013638039 6:112047607-112047629 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1014463665 6:121729743-121729765 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1015643693 6:135364116-135364138 ATGCTCCTCACTTCCCAGACAGG + Intronic
1015757522 6:136622500-136622522 AAGCTCCTCACATGCCCGACTGG + Intronic
1016973688 6:149786852-149786874 ACGCTCCTCATATCCCAGACGGG + Intronic
1016993864 6:149947414-149947436 ACTCTCCTCAGATGCCAGGGAGG - Exonic
1017001416 6:150000081-150000103 ACTCTCCTCAGATGCCAGGGAGG + Intergenic
1017004469 6:150020123-150020145 ACTCTCCTCAGATGCCAGGGAGG + Exonic
1017215217 6:151899738-151899760 ACGCTCCTCACATCCCAGACGGG + Intronic
1017285505 6:152670788-152670810 ATGTGCCTCAATTGCCAGGAGGG - Intergenic
1017358444 6:153537576-153537598 ATGCTGCTGGAATGCCATGCTGG - Intergenic
1017816668 6:158021436-158021458 GTGCTCCTCCAACACCAGGCGGG + Intronic
1017855886 6:158349730-158349752 GTGCTCCTCAATTCCCAGACGGG + Intronic
1018181044 6:161223744-161223766 TGGCTCCTCAAATGCAGGGCAGG + Intronic
1018528225 6:164736576-164736598 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1019651531 7:2161799-2161821 ATGCTCCTCACCTCCCAGACGGG - Intronic
1019981336 7:4624043-4624065 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1020498806 7:8890381-8890403 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1020498874 7:8890653-8890675 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1020831645 7:13102452-13102474 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1021331832 7:19347496-19347518 AAGCTCCTTACATGCCAGACTGG + Intergenic
1021408601 7:20303022-20303044 ATGCTCCTCCAGTAACAGGCAGG - Intergenic
1022005329 7:26261763-26261785 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1022005365 7:26261919-26261941 GTGCTCCTCACATCCCAGACGGG - Intergenic
1022083253 7:27044735-27044757 GCGCTCCTCACATCCCAGGCGGG - Intergenic
1022187880 7:27987426-27987448 ATGCTCCTCACTTCCCAGACGGG - Intronic
1022757163 7:33304506-33304528 ACGCTCCTCAGATCCCAGACGGG - Intronic
1023104235 7:36747792-36747814 AAGCTCCTGAAATGCCACACTGG - Intergenic
1023262769 7:38374700-38374722 AAGGTCCCCAAATGCAAGGCAGG + Intergenic
1023843400 7:44108673-44108695 ATGCTCCTGGAAGGCCGGGCTGG + Intronic
1024256849 7:47545841-47545863 CTGCTCCTCAAATCCCCTGCAGG + Intronic
1025011672 7:55402820-55402842 ACGCTCCTCACATCCCAGACGGG + Intronic
1025011697 7:55402936-55402958 ATGCTCCTCACTTTCCAGACTGG + Intronic
1025803690 7:64809759-64809781 ATGCTCCTCACCTCCCAGACGGG + Intronic
1025803702 7:64809799-64809821 GTGCTCCTCACATCCCAGACGGG + Intronic
1025803754 7:64810031-64810053 ATGCTCCTCACTTCCCAGACAGG + Intronic
1026783517 7:73284821-73284843 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1026862169 7:73797655-73797677 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1026864436 7:73814505-73814527 ATGCCTGTCCAATGCCAGGCTGG - Intronic
1026868126 7:73835635-73835657 ATGCTCCTCACTTCCCAGACGGG - Intronic
1026868181 7:73835867-73835889 GTGCTCCTCACATCCCAGACGGG - Intronic
1026868193 7:73835907-73835929 ATGCTCCTCACCTCCCAGACGGG - Intronic
1028227480 7:88266695-88266717 ACGCTCCTCACATCCCAGACGGG + Intergenic
1028535745 7:91888031-91888053 ATGCTCCTCACTTTCCAGACGGG - Intergenic
1028548148 7:92027022-92027044 ACGCTCCTCACATCCCAGACAGG - Intronic
1028548210 7:92027283-92027305 GTGCTCCTCACATCCCAGACGGG - Intronic
1028685599 7:93586230-93586252 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1028685643 7:93586387-93586409 ATGCTCCTCACCTCCCAGACAGG + Intergenic
1029594191 7:101528165-101528187 CTGCTCCTCACCTGCCAAGCAGG + Intronic
1030692615 7:112551438-112551460 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1030725671 7:112922610-112922632 GTGCTCCTCACATCCCAGACGGG - Intronic
1032291040 7:130590830-130590852 ACGCTCCTCACATCCCAGACGGG - Intronic
1032569505 7:132984677-132984699 ACGCTCCTCACATCCCAGACGGG - Intronic
1033185722 7:139225705-139225727 ATGCTCCTCACCTGCCAGATGGG - Intergenic
1033185747 7:139225812-139225834 ATGCTCCTCACCTGCCAGATGGG - Intergenic
1033185792 7:139225995-139226017 ATGCTCCTCACCTGCCAGATGGG - Intergenic
1033185853 7:139226215-139226237 ATGCTCCTCACCTGCCAGATGGG - Intergenic
1033185901 7:139226396-139226418 GCGCTCCTCAACTCCCAGGCGGG - Intergenic
1033294029 7:140114782-140114804 GTGCTCCTCACATCCCAGACGGG - Intronic
1034712322 7:153204545-153204567 ATGCTCCTCAGAAGACAGGCTGG - Intergenic
1034723531 7:153315346-153315368 ATGCTCCTCACCTCCCAGACCGG + Intergenic
1034723574 7:153315503-153315525 GTGCTCCTCACATACCAGACGGG + Intergenic
1036095911 8:5725141-5725163 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1036482991 8:9154188-9154210 ATGCTCCTCACCTCCCAGACAGG + Exonic
1036483002 8:9154228-9154250 GTGCTCCTCACATCCCAGACGGG + Exonic
1036636071 8:10550312-10550334 CAGCTCCTGAAATGCAAGGCTGG + Intronic
1037617839 8:20535508-20535530 ATGCTGCTCATATTCCAGGCAGG + Intergenic
1037756283 8:21712308-21712330 ATGCTCCTCACCTCCCAGACGGG + Intronic
1037908739 8:22730712-22730734 GTGTTCCTCAAATGCTGGGCTGG - Intronic
1038340888 8:26684026-26684048 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1039201077 8:35094572-35094594 ATGCTCCTCACTTTCCAGACCGG + Intergenic
1039488177 8:37927775-37927797 GTGCTCCTCACATCCCAGACGGG - Intergenic
1039650925 8:39339317-39339339 ATGCTCCTCACCTCCCAGACAGG + Intergenic
1039961930 8:42254930-42254952 ATGCTCCTCACTTCCCAGACAGG - Intergenic
1040096605 8:43450676-43450698 ATGCTCCACAAATAGCAGGCAGG - Intergenic
1040121397 8:43688137-43688159 ATGCTCCTCACTTTCCAGACTGG + Intergenic
1040785451 8:51159065-51159087 ACGCTCCTCACATCCCAGACGGG - Intergenic
1040916815 8:52572998-52573020 GTGCTCCTCACTTCCCAGGCGGG + Intergenic
1041329722 8:56711858-56711880 ATTCTCTTGCAATGCCAGGCGGG - Intergenic
1041920876 8:63180276-63180298 ATGCTCCTCACATCCCGGACGGG + Intronic
1042139269 8:65662596-65662618 ACGCTCCTCACATCCCAGACTGG - Intronic
1042290822 8:67167870-67167892 ATGCTCCTCACTTCCCAGACGGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1044507557 8:93039110-93039132 ACGCTCCTCAATTTCCAGACTGG - Intergenic
1044969358 8:97604776-97604798 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1045235715 8:100351180-100351202 ATGCTCCTCACTTCCCAGACGGG - Intronic
1045414311 8:101951442-101951464 ATGCTCCACAAATGTCAGGGAGG + Intronic
1046736076 8:117777840-117777862 ACGCTCCTCACTTCCCAGGCCGG - Intergenic
1047266504 8:123314471-123314493 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1047266560 8:123314703-123314725 GTGCTCCTCACATCCCAGACGGG - Intergenic
1047266572 8:123314743-123314765 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1047388579 8:124432014-124432036 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1047782221 8:128119311-128119333 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1048835578 8:138515853-138515875 ATGCAGCTCACATGCCAGCCTGG + Intergenic
1050417535 9:5432955-5432977 ATGCTCCTCACCTCCCAGACAGG - Intronic
1050534899 9:6622896-6622918 GTGCTCCTCACATCCCAGACCGG - Intronic
1051276834 9:15406480-15406502 GTGCTCCTCACATCCCAGACGGG - Intergenic
1051276846 9:15406520-15406542 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1051661955 9:19434270-19434292 ATGCTCCTCACTTTCCAGACTGG + Intronic
1052236230 9:26215239-26215261 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1052259119 9:26492802-26492824 GTGCTCCTCACATCCCAGACGGG - Intergenic
1052259286 9:26493329-26493351 ATGCCCCTCACCTCCCAGGCGGG - Intergenic
1052880981 9:33600786-33600808 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1052928605 9:34038705-34038727 ATGCTCCTCACTTCCCAGACGGG - Intronic
1052928675 9:34038974-34038996 ACGCTCCTCAACTCCCAGACGGG - Intronic
1052941891 9:34137533-34137555 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1053048085 9:34936723-34936745 GTGCTCCTCACATCCCAGACGGG - Intergenic
1053467993 9:38324719-38324741 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1055133969 9:72806602-72806624 ATGCTCCTCACCTCCCAGACGGG + Intronic
1055242100 9:74197656-74197678 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1055297921 9:74852913-74852935 ATGCTCCTCACTTCCCAGACGGG - Intronic
1055506636 9:76955478-76955500 ACGCTCCTCACATCCCAGACGGG - Intergenic
1055586027 9:77760901-77760923 ATGCTCCTCACCTCCCAGACGGG - Intronic
1055702816 9:78964406-78964428 ATTCTCCTCAAAAGCCAGGTAGG + Intergenic
1056097851 9:83272951-83272973 ATGCTCCTCACTTCCCAGACGGG - Intronic
1056409510 9:86312042-86312064 ATGCTCCTCACTTCCCAGACGGG - Intronic
1056624910 9:88245324-88245346 ACGCTCCTCACATCCCAGACGGG + Intergenic
1056918396 9:90764048-90764070 TTACTCCTCTGATGCCAGGCAGG - Intergenic
1057071888 9:92106007-92106029 GTGCTCCTCACTTGCCAGACAGG - Intronic
1057087922 9:92227909-92227931 ATGCTCCTCACTTCCCAGACGGG + Intronic
1057630494 9:96715781-96715803 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1057630515 9:96715861-96715883 GTGCTCCTCACATCCCAGACGGG + Intergenic
1057716263 9:97498466-97498488 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1057751440 9:97796382-97796404 ATGCTCCTCACCTTCCAGACTGG - Intergenic
1057838226 9:98464172-98464194 ATGCTCCTCAATTCCTAGACGGG - Intronic
1058049573 9:100392733-100392755 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1058049684 9:100393108-100393130 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1058368191 9:104234950-104234972 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1058661298 9:107271545-107271567 ACGCTCCTCACATCCCAGACGGG - Intergenic
1058902173 9:109451632-109451654 ATGTCCCTCAAATGACAGGAAGG + Intronic
1058972695 9:110097658-110097680 ATGCTCCTCACTTTCCAGACTGG + Intronic
1059879938 9:118678270-118678292 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1060369688 9:123057394-123057416 GTGCTCCTCACATCCCAGACGGG + Intronic
1060625538 9:125108486-125108508 ACGCTCCTCACATCCCAGACGGG - Intronic
1060669853 9:125459312-125459334 ATGCTCCTCACTTTCCAGACTGG + Intronic
1060682270 9:125577017-125577039 ATGCTCCTCACTTTCCAGACTGG - Intronic
1061143057 9:128780171-128780193 ACGCTCCTCACATCCCAGACGGG - Intergenic
1061427228 9:130506929-130506951 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1061977284 9:134075813-134075835 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1062396981 9:136356533-136356555 ATGCTCATCAAGTACCAGGTGGG + Exonic
1062606763 9:137351999-137352021 ATGCTCCTCCAGTGCCTGGCAGG + Intronic
1203562562 Un_KI270744v1:71273-71295 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1203634429 Un_KI270750v1:97353-97375 GTGCTCCTCACATCCCAGACGGG + Intergenic
1185584605 X:1235459-1235481 ACGCTCCTCACATCCCAGACGGG - Intergenic
1186786895 X:12963418-12963440 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1186922961 X:14302722-14302744 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1186922993 X:14302841-14302863 GTGCTCCTCACATCCCAGACGGG + Intergenic
1187183764 X:16965567-16965589 ACGCTCCTCACATCCCAGACGGG + Intronic
1187976649 X:24709887-24709909 ATGCTCCTCACTTTCCAGACTGG + Intronic
1187995783 X:24924871-24924893 ATGCCCCTCAACTGCCAGCCTGG - Intronic
1188214291 X:27458493-27458515 ACGCTCCTCACATCCCAGACAGG - Intergenic
1189056836 X:37707351-37707373 ATGCTCCTCACTTCCCAGACGGG + Intronic
1189421514 X:40862006-40862028 GTGCTCCTCACATCCCAGACTGG - Intergenic
1189505799 X:41612198-41612220 ATGCTCCTCACTTTCCAGACTGG - Intronic
1190174735 X:48139263-48139285 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1190505262 X:51119715-51119737 ATGCTCCTCACCTCCCAGACAGG + Intergenic
1190891506 X:54572730-54572752 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1190906803 X:54736490-54736512 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1191637336 X:63393092-63393114 GTGCTCCTCACATCCCAGACGGG - Intergenic
1191637375 X:63393249-63393271 ATGCTCCTCACTTCCCAGACAGG - Intergenic
1192252127 X:69422090-69422112 ATGCTCCTCACCTCCCAGACAGG - Intergenic
1192252146 X:69422167-69422189 ATGCTCCTCACTTCCCAGACTGG - Intergenic
1192350100 X:70349590-70349612 ATGCTCCTCACATCCCAGACGGG + Intronic
1192350155 X:70349787-70349809 ATGCTCCTCACATCCCAGACGGG + Intronic
1192464149 X:71342027-71342049 ACGCTCCTCAATTTCCAGACTGG + Intergenic
1192476985 X:71452205-71452227 ATGCTCCTCACTTCCCAGACGGG + Intronic
1192477040 X:71452402-71452424 GTGCTCCTCACATCCCAGACGGG + Intronic
1192500150 X:71645169-71645191 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1192658963 X:73022129-73022151 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1192663867 X:73068893-73068915 GTGCTCCTCACCTCCCAGGCGGG - Intergenic
1192739837 X:73882108-73882130 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1193326346 X:80182195-80182217 TTACTCCTCCAATGCTAGGCAGG + Intergenic
1193328957 X:80215114-80215136 ATGCTCCTCACATCCCAGACAGG - Intergenic
1193345238 X:80397074-80397096 ATGCTCCTCACTTCCCAGACGGG + Intronic
1193362130 X:80590887-80590909 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1193362177 X:80591083-80591105 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1193372310 X:80712763-80712785 ATGCTCCTCACATCCCAGACGGG - Intronic
1195009761 X:100723698-100723720 ACGCTCCTCACATCCCAGACGGG - Intronic
1195036227 X:100973015-100973037 ATGCTCCTCACCTCCCAGACGGG + Intronic
1195257619 X:103104853-103104875 ATGCTCCTCACTTCCCAGACGGG + Intergenic
1195978891 X:110558086-110558108 ATGCTCCTCAATTCCCAGACAGG + Intergenic
1195979005 X:110558604-110558626 ATGCTCCTCACATCCCAGATGGG + Intergenic
1196778478 X:119361894-119361916 ATGCTCCTCACTTTCCAGACTGG - Intergenic
1196778505 X:119362010-119362032 ACGCTCCTCACATCCCAGACGGG - Intergenic
1197452858 X:126641176-126641198 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1197452909 X:126641372-126641394 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1197455698 X:126674070-126674092 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1198246774 X:134839116-134839138 ATGCTCCTCACTTCCCAGACGGG - Intronic
1198246832 X:134839349-134839371 ATGCTCCTCACCTCCCAGACGGG - Intronic
1198260431 X:134960471-134960493 ATGCTCCTCACTTCCCAGACGGG - Intergenic
1198272645 X:135068873-135068895 TTACTCCTCCAATGCTAGGCAGG + Intergenic
1199452779 X:147992914-147992936 ATGCTCCTCACTTTCCAGGCTGG + Intronic
1199586443 X:149420941-149420963 ATGCTCCTCACTTCCCAGACTGG - Intergenic
1199765241 X:150936600-150936622 ATGCTCTTACAATGCCAGGAGGG - Intergenic
1199972290 X:152870272-152870294 AAGCCCCTGTAATGCCAGGCAGG + Intergenic
1200498341 Y:3914204-3914226 TTACTCCTCCAATGCTAGGCAGG - Intergenic
1201294717 Y:12453500-12453522 GCGCTCCTCAAATCCCAGACGGG + Intergenic
1201440270 Y:14000980-14001002 ATGCTCCTCACCTCCCAGACGGG + Intergenic
1201444301 Y:14041728-14041750 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1201948254 Y:19535661-19535683 ATGCTCCTCACCTCCCAGACGGG - Intergenic
1202028905 Y:20552244-20552266 ACGCTCCTCACTTCCCAGGCGGG - Intergenic