ID: 1129111615

View in Genome Browser
Species Human (GRCh38)
Location 15:73340337-73340359
Sequence CTGGAGACACGAATGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129111603_1129111615 15 Left 1129111603 15:73340299-73340321 CCCTGGAGGAGTAAGGTCAGCCC 0: 1
1: 0
2: 0
3: 18
4: 139
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111600_1129111615 23 Left 1129111600 15:73340291-73340313 CCCTCAGGCCCTGGAGGAGTAAG 0: 1
1: 0
2: 1
3: 13
4: 238
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111610_1129111615 -5 Left 1129111610 15:73340319-73340341 CCCCTGGGAGGCTGAGGCCTGGA 0: 1
1: 1
2: 7
3: 78
4: 778
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111611_1129111615 -6 Left 1129111611 15:73340320-73340342 CCCTGGGAGGCTGAGGCCTGGAG 0: 1
1: 0
2: 19
3: 424
4: 2360
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111612_1129111615 -7 Left 1129111612 15:73340321-73340343 CCTGGGAGGCTGAGGCCTGGAGA 0: 1
1: 2
2: 26
3: 224
4: 2120
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111598_1129111615 29 Left 1129111598 15:73340285-73340307 CCACAGCCCTCAGGCCCTGGAGG 0: 1
1: 0
2: 11
3: 88
4: 748
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111604_1129111615 14 Left 1129111604 15:73340300-73340322 CCTGGAGGAGTAAGGTCAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139
1129111601_1129111615 22 Left 1129111601 15:73340292-73340314 CCTCAGGCCCTGGAGGAGTAAGG 0: 1
1: 0
2: 2
3: 51
4: 389
Right 1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129111615 Original CRISPR CTGGAGACACGAATGGATGC TGG Intronic
915835139 1:159170903-159170925 CTGGGGCCACGAATTGTTGCTGG + Intergenic
918134623 1:181660657-181660679 CCTGAGACAGGAATGGCTGCTGG + Intronic
919334474 1:196214425-196214447 TTGGAGAAAAGAATGGAAGCAGG + Intergenic
920358138 1:205391415-205391437 CTGGAAACACCAAGGGATGCAGG + Intronic
924165605 1:241278923-241278945 CTGGAGAAAAGAATGGAAGCAGG + Intronic
1063383276 10:5600120-5600142 CTGGAGGCATGAATGGATGGCGG - Intergenic
1067437029 10:46285373-46285395 CTGAAGCAAAGAATGGATGCCGG + Intergenic
1068042065 10:51837660-51837682 CTGGAGAGACAAATGCATGTAGG - Intronic
1068462302 10:57343647-57343669 CTGGAGACAGAAATGAATGTGGG + Intergenic
1069534336 10:69241837-69241859 CTGGGGACAAGAGTGGAAGCAGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075803346 10:125166970-125166992 ATGGAGACACGACTGGATGAGGG - Intergenic
1075878186 10:125824941-125824963 ATGGAGAGAAGCATGGATGCAGG + Intronic
1075962949 10:126585085-126585107 CTGGAGACAGGAATTCCTGCTGG + Intronic
1078938326 11:15972715-15972737 GTGGAGCCACAAATGCATGCGGG + Exonic
1081626451 11:44658856-44658878 ATGGAGACATGGATGGATGAAGG + Intergenic
1084330851 11:68429368-68429390 ATTGACACACAAATGGATGCCGG - Intronic
1085137769 11:74109120-74109142 CTGGAAACACAAATCGCTGCTGG + Exonic
1085738585 11:79060632-79060654 CTGCAGACTCAAATGGAGGCAGG + Intronic
1088810484 11:113388366-113388388 CTGGAGAGAAGGATGGAAGCAGG - Intronic
1090865004 11:130692004-130692026 ATGAAGACAGGAATGGATACAGG - Intronic
1091624557 12:2112198-2112220 ATGGAGACACGCATGCTTGCTGG + Intronic
1097388155 12:58975796-58975818 CTGGAGACAGGAGGGGATGCAGG - Intergenic
1099736600 12:86575126-86575148 CTGGTGACATGAATGAATGAGGG - Intronic
1102744620 12:115239565-115239587 CTGGAGAGACGCAAGGTTGCTGG - Intergenic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1105797074 13:23865969-23865991 CTGGGGACACTAATTGAGGCAGG - Intronic
1105855075 13:24365427-24365449 CCGGGGAAATGAATGGATGCTGG - Intergenic
1105896821 13:24723703-24723725 CTGGAGTCATGAAGGGAGGCAGG - Intergenic
1106134999 13:26967404-26967426 CTGGAGACAGGACAGGATGCTGG - Intergenic
1107609537 13:42099372-42099394 CTGCACACATGAAGGGATGCAGG - Intronic
1109092551 13:58067481-58067503 CTGCAGAAATGGATGGATGCTGG + Intergenic
1109281815 13:60365116-60365138 CTGGACACAGCAATGGATACAGG - Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1111461490 13:88548266-88548288 CTGGAGACAAGAAAGAATGATGG - Intergenic
1113741249 13:112713971-112713993 CTGGGGCCAGGAATGGAAGCTGG - Intronic
1117195217 14:53333329-53333351 CAGGAGTCACCAATGGAAGCTGG - Intergenic
1122343393 14:101043382-101043404 CCGGACACACGAATGGGTGGTGG + Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124479437 15:30065003-30065025 CTGGAGGCATGAATGGAGGCTGG - Intergenic
1125432503 15:39609595-39609617 CTAGAGAAACACATGGATGCAGG - Intronic
1128541390 15:68536912-68536934 CTGGAGCCAGGAAGTGATGCTGG + Intergenic
1128757504 15:70193548-70193570 CTGGTGCCAAGAATGGATGCAGG + Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1129389000 15:75211184-75211206 CCGGGGCCACGAGTGGATGCTGG + Exonic
1129701214 15:77769589-77769611 CTGGAGGCAAGGATGGAGGCAGG + Intronic
1130638661 15:85649568-85649590 CCAGAGACACAAATGGCTGCAGG - Intronic
1131599806 15:93835693-93835715 TTAGAGACTGGAATGGATGCTGG + Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1138335382 16:56248921-56248943 CCAGAGACAGGAATAGATGCAGG + Intronic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1149675987 17:58462037-58462059 CTGGAGACGTGGAAGGATGCGGG - Intronic
1150583137 17:66493564-66493586 CGGGAGACAGGAAGGGAGGCAGG - Intronic
1151468894 17:74305456-74305478 CTGGGGACAGGAGGGGATGCAGG + Intronic
1153312285 18:3688836-3688858 CTGGAGACCAGAAAGGAGGCCGG - Intronic
1157468578 18:47969609-47969631 CAGGAGACACTGATGGTTGCAGG - Intergenic
1158349505 18:56550651-56550673 GTGTAGACAGGAATGGACGCTGG - Intergenic
1162333441 19:10045114-10045136 CTGGAGACAAAAAGGAATGCAGG + Intergenic
1164715476 19:30387687-30387709 CTGCAGACACTAATGGCTGGAGG + Intronic
1166253498 19:41586652-41586674 CTGGGGACAGGAAGGGATGGGGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166929327 19:46292067-46292089 ATGGAGAGATGAATGGATGGAGG - Intergenic
1168269149 19:55240206-55240228 CTGGAGACATGAAGGGCAGCAGG + Intronic
925106897 2:1299461-1299483 GTGGAGACAGGGATGGAAGCTGG - Intronic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
934673725 2:96234411-96234433 CAGGAGACAGGAATGGAGGAGGG - Intergenic
936077242 2:109409393-109409415 CTGGAGACAGCAGTGGATGGTGG + Intronic
943897107 2:193378293-193378315 CTGGAGACCCCAATGGTGGCAGG + Intergenic
946865993 2:224041111-224041133 ATTGAGACAGAAATGGATGCAGG - Intergenic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
948733499 2:239982591-239982613 CTGGAGACAGGAATGTGTGCAGG - Intronic
948738040 2:240023090-240023112 CTGGAGACAGGCATTGAAGCAGG - Intronic
948940776 2:241195270-241195292 CATGAGACAGCAATGGATGCTGG - Intronic
1169014776 20:2282643-2282665 AGGGAGGCAAGAATGGATGCTGG + Intergenic
1171933352 20:31248438-31248460 AGGAAGACACTAATGGATGCAGG - Intergenic
1173075232 20:39812169-39812191 GTGGAGACAGGAAAGGGTGCAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174799060 20:53547705-53547727 CTGTAGACAGGAATGTATGCAGG + Intergenic
1179228870 21:39482131-39482153 CTGGAGACTGGATTGGATGCAGG - Intronic
1180936611 22:19629641-19629663 CTGGAGAGGAGAATGGAGGCTGG + Intergenic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1182042443 22:27248982-27249004 CTGGACACAGGGATGGATGTGGG + Intergenic
1182047870 22:27289731-27289753 AAGGAGACATGAATTGATGCTGG - Intergenic
1185242672 22:49755047-49755069 CTGCAGACAGGCAGGGATGCCGG - Intergenic
952933782 3:38379694-38379716 CTGGGGACATGAATGGATCTTGG + Intronic
953374783 3:42419548-42419570 CTGGAGACAAGAAAAGTTGCTGG + Intergenic
954333352 3:49902468-49902490 CTGGACACACTAATTGATGAGGG - Exonic
954351167 3:50045218-50045240 CTGGAGGCATTAATGGATTCAGG - Intronic
956681532 3:71785610-71785632 CTGAACAAACGAATGGATTCAGG - Intergenic
956996081 3:74827750-74827772 TTGGAGACCTGAAAGGATGCGGG + Intergenic
958603722 3:96331750-96331772 CTGGAGACACGAGTGGAAAAGGG + Intergenic
961737742 3:129012739-129012761 CAGGAGACAGAAAAGGATGCAGG + Intronic
964008439 3:151860055-151860077 CTGGAAAAAGGAATGGAGGCAGG + Intergenic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
965920691 3:173909542-173909564 CTGGAGAAGCTAATGGTTGCTGG + Intronic
966904679 3:184513646-184513668 CTGGAGACCCGAGTGTGTGCGGG - Intronic
969876609 4:10140070-10140092 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876613 4:10140089-10140111 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876617 4:10140108-10140130 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
969876621 4:10140127-10140149 CTGGAGACGCGCAGGGAGGCTGG - Intergenic
978958272 4:114641522-114641544 CTGTAAACCCTAATGGATGCTGG + Intronic
979093475 4:116516878-116516900 ATGGAGACAAGAATGTAGGCTGG - Intergenic
992876460 5:81060374-81060396 CTGGAGAAACGACTTGAAGCAGG - Intronic
996174245 5:120335018-120335040 CTGGAGGGAAGACTGGATGCAGG + Intergenic
998373147 5:141673770-141673792 CTGGAGGCACGGGAGGATGCTGG - Exonic
1000202670 5:159027065-159027087 ATGGAGGGACGAATGGATCCAGG - Intronic
1001288913 5:170442794-170442816 CAGGGGACAGGAATGGAGGCAGG + Intronic
1001437941 5:171715060-171715082 CTGGCCACACCAATGGGTGCAGG + Intergenic
1002479593 5:179491358-179491380 CTAGAGACACGATTGGACTCTGG + Intergenic
1003534992 6:6969015-6969037 CTGGACTCATGAATGGATTCAGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006145726 6:31958629-31958651 CTGGAGACAGGAGGGAATGCTGG - Intronic
1010427090 6:75739815-75739837 CTAGAGACAGGCCTGGATGCAGG + Intergenic
1015810388 6:137156640-137156662 TTAGAGACAGGAATGGATTCAGG + Intronic
1016624933 6:146155957-146155979 CTGAGAACAAGAATGGATGCCGG + Intronic
1017233664 6:152098178-152098200 TTGGAGACATGGATGGAAGCTGG + Intronic
1020283836 7:6664895-6664917 CTGGAGTCAAAAAGGGATGCGGG + Intergenic
1022628026 7:32058223-32058245 CTGGAGAAAAGAATGGAGACAGG - Intronic
1022847788 7:34228237-34228259 CTGAAGACAGGAATGGCAGCAGG - Intergenic
1024094621 7:45974013-45974035 CAGGAGACAGTAGTGGATGCTGG - Intergenic
1029327584 7:99823280-99823302 CTGGTGCCAAGAATGGAAGCAGG + Intergenic
1030983486 7:116212486-116212508 CTGGAGACAGGAAGGCATGGGGG + Intronic
1032859604 7:135864713-135864735 CAGGAGAAACGCATGGATCCAGG - Intergenic
1033604389 7:142915246-142915268 CTGGAGACAGGAAAAGATTCTGG + Intronic
1034070368 7:148179176-148179198 CTTGAGTCAGGAAGGGATGCAGG - Intronic
1035059086 7:156055947-156055969 CTGGTGTGGCGAATGGATGCGGG - Intergenic
1035103404 7:156420082-156420104 CTGGAATTACCAATGGATGCTGG - Intergenic
1036992331 8:13612269-13612291 TTGGAGACAGGCATGGATACAGG - Intergenic
1037807058 8:22064058-22064080 ATGGAGAGATGGATGGATGCAGG + Intronic
1038845943 8:31229719-31229741 TTGGAGACAAGAATGGTTGAGGG + Intergenic
1040594898 8:48827894-48827916 AAGGAGACAGGAATGCATGCAGG + Intergenic
1042665545 8:71201044-71201066 CTGGTGACATGAGTGGCTGCAGG + Intronic
1046543157 8:115612661-115612683 CTGGACACATGAAAGGATGCAGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047764643 8:127980513-127980535 CTGGAGACTTGAATGGATATGGG + Intergenic
1048080528 8:131121787-131121809 CTGGAGCCTGGAATGGATCCAGG + Intergenic
1048649998 8:136465237-136465259 GTGGAGACATGCATGAATGCAGG - Intergenic
1048867089 8:138769213-138769235 CTCATGACATGAATGGATGCAGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1050818743 9:9850291-9850313 CTGGAGACAGGAAAGAATTCTGG + Intronic
1052865831 9:33464162-33464184 CTAGAGACAAGAATGGGTCCTGG + Intronic
1056733568 9:89185626-89185648 CAGGAGTCAGGAATGGATGTGGG + Intergenic
1059670477 9:116486400-116486422 ATGAAGAGACGAATGGATGGAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061222277 9:129259073-129259095 ATGGATAGGCGAATGGATGCAGG - Intergenic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1203718293 Un_KI270742v1:177039-177061 CTGGAGACCCGTATGGCTTCAGG - Intergenic
1195520200 X:105821687-105821709 CTGGAGGCTGGAAGGGATGCAGG + Intergenic
1198390865 X:136172458-136172480 CAGTAGACAGGTATGGATGCAGG + Intronic
1198557911 X:137815612-137815634 CTGGAGATAGGAAGGGATGTGGG + Intergenic
1199336825 X:146628354-146628376 CTGGAGACTGGGATGGATGTGGG - Intergenic
1199511789 X:148630648-148630670 CTGGGGACAGGAATGGACACAGG - Intronic