ID: 1129115105

View in Genome Browser
Species Human (GRCh38)
Location 15:73361256-73361278
Sequence CACCCACTCGGATCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129115105_1129115110 2 Left 1129115105 15:73361256-73361278 CCCACCTCAGATCCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1129115110 15:73361281-73361303 GATGGTACAGTGTCTCCCAGTGG 0: 1
1: 0
2: 2
3: 6
4: 122
1129115105_1129115112 17 Left 1129115105 15:73361256-73361278 CCCACCTCAGATCCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1129115112 15:73361296-73361318 CCCAGTGGCTTCCTAGCCCTTGG 0: 1
1: 0
2: 3
3: 31
4: 298
1129115105_1129115114 18 Left 1129115105 15:73361256-73361278 CCCACCTCAGATCCGAGTGGGTG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1129115114 15:73361297-73361319 CCAGTGGCTTCCTAGCCCTTGGG 0: 1
1: 0
2: 1
3: 35
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129115105 Original CRISPR CACCCACTCGGATCTGAGGT GGG (reversed) Intronic
901832142 1:11899019-11899041 GACCCACCTGGATCCGAGGTCGG + Intergenic
904297164 1:29527480-29527502 CACCCACTCAGATCTGTGCCAGG - Intergenic
904652325 1:32014529-32014551 CACGCACTCCGGGCTGAGGTGGG - Intronic
906611725 1:47208551-47208573 CAGCCACTTGGGTCTGAGGAGGG + Intergenic
911359869 1:96862999-96863021 CTCCCACGAGGAGCTGAGGTAGG - Intergenic
913283222 1:117205266-117205288 CAGCTACTCGGGACTGAGGTGGG - Intronic
915299290 1:154942776-154942798 CACCCTCTGGGAACTCAGGTAGG + Intergenic
915585476 1:156841660-156841682 CACCCACTCGGATGTCTGGTGGG - Exonic
922000445 1:221472599-221472621 CAGCTACTCGGGGCTGAGGTAGG - Intergenic
923326411 1:232884172-232884194 CACCATCTGGGAGCTGAGGTGGG + Intergenic
1065318178 10:24484845-24484867 CAGCCCTTCGGATCTGAGGGGGG + Intronic
1071337078 10:84609277-84609299 CACCCACAGGGACCTGAGATTGG - Intergenic
1075242620 10:120792613-120792635 CACCCACTCTCCTCTGATGTTGG + Intergenic
1079049527 11:17141381-17141403 CAGCTACTCGGGGCTGAGGTAGG - Intronic
1079085692 11:17443300-17443322 CACCCACAATGATCTGAGGAAGG + Exonic
1084398647 11:68931167-68931189 CACCCACTCGGATCTCAGAGTGG - Intronic
1085864460 11:80273086-80273108 CACCCACTGGGACCTGTCGTGGG - Intergenic
1090617858 11:128532545-128532567 CATCAACTTGGAGCTGAGGTGGG - Intronic
1092352115 12:7764028-7764050 CAGCTACTTGGAGCTGAGGTAGG + Intergenic
1093564187 12:20582302-20582324 CAGCTACTTGGGTCTGAGGTGGG - Intronic
1104730734 12:131103982-131104004 CGCCCCCTCGGTTCTGAAGTCGG - Intronic
1118485002 14:66206436-66206458 CACACACTCGGGACTGTGGTGGG + Intergenic
1119438996 14:74615738-74615760 GGCCCACGGGGATCTGAGGTGGG - Intergenic
1122491167 14:102116997-102117019 CACCCACTCCGATCTCAGAGTGG + Intronic
1122671834 14:103378699-103378721 GACCCACTCTGCTCTGAGCTGGG - Intergenic
1124005477 15:25792503-25792525 CACCCACGTGGGTCTGGGGTTGG - Intronic
1128719321 15:69934766-69934788 CAGCCAGTAGGATCTGAGGCCGG - Intergenic
1129115105 15:73361256-73361278 CACCCACTCGGATCTGAGGTGGG - Intronic
1132491148 16:232061-232083 CAGCCACTCGAAGCTGAGGTTGG + Intergenic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1136032950 16:27516744-27516766 CAGCTACTCGGAGGTGAGGTGGG - Intronic
1136752398 16:32651065-32651087 CACCGACGCGGCTCTGAGGGCGG - Intergenic
1136822193 16:33329397-33329419 CACCGACGCGGCTCTGAGGGCGG + Intergenic
1136828756 16:33385936-33385958 CACCGACGCGGCTCTGAGGGCGG + Intergenic
1136833822 16:33484718-33484740 CACCGACGCGGCTCTGAGGGCGG + Intergenic
1138830914 16:60373753-60373775 CACACACTGGGGTCTGTGGTTGG - Intergenic
1139392762 16:66615567-66615589 CTTCCACTCGGATCTCAGATTGG - Exonic
1203011094 16_KI270728v1_random:239802-239824 CACCGACGCGGCTCTGAGGGCGG - Intergenic
1144530645 17:16035653-16035675 CAGCTACTTGGGTCTGAGGTGGG - Intronic
1148713948 17:49702230-49702252 CAGCTACTCGGGGCTGAGGTGGG - Intronic
1149263103 17:54900518-54900540 CGCCCGCTCGGATCCCAGGTGGG - Exonic
1150421307 17:65038522-65038544 CAGCTACTCAGAGCTGAGGTGGG - Intronic
1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG + Exonic
1152242187 17:79166490-79166512 CACCCACGGGGAGCTGAGATGGG + Intronic
1152530989 17:80918984-80919006 CACACACCCGGGTCTGAGGAGGG + Intronic
1152812690 17:82389612-82389634 CAGCTACTCGGAGCTGAGGCAGG - Intronic
1153890608 18:9510904-9510926 CACACACTGGGACCTGTGGTGGG - Intronic
1156781712 18:40858104-40858126 CAGCCACTCGGGGCTGAGGCAGG + Intergenic
1157131063 18:45007854-45007876 GATCCACTCTGACCTGAGGTGGG - Intronic
1157203303 18:45677412-45677434 CAGCCTCTCAGATCTGAGGTTGG - Intronic
1159111932 18:64069618-64069640 CTCCTACTGGGATCTGAAGTTGG - Intergenic
1164473303 19:28553881-28553903 CAACCACTGTGATCTGAGGAGGG - Intergenic
1166922214 19:46236808-46236830 CACCCACTCCCTTCTGAGATGGG - Intergenic
1167235039 19:48309156-48309178 CACCCACTCTGATCTCAGAGAGG + Intronic
926571793 2:14537126-14537148 CGGCCTCTAGGATCTGAGGTTGG + Intergenic
930451801 2:51550313-51550335 CACACACTGGGGTCTGTGGTAGG - Intergenic
931994083 2:67823297-67823319 CAGCTACTCGGAGCTGAGGCAGG + Intergenic
935622181 2:105139814-105139836 CACCCACTCGGAACTCAGCCTGG - Intergenic
940749786 2:157612501-157612523 CTGCCACTGGGAGCTGAGGTGGG - Intronic
942190758 2:173467279-173467301 CACTCACTTGGATGTGATGTAGG - Intergenic
942247650 2:174022711-174022733 CAGCTACTTGGAGCTGAGGTGGG + Intergenic
943578743 2:189660121-189660143 CAACCACTCGGGGCTGAGGTGGG - Intergenic
944579363 2:201118446-201118468 CACCTACTAGGAGCTGCGGTAGG - Intronic
946427501 2:219607043-219607065 CACGGACTCGGCTCTGAGGTTGG - Exonic
948305336 2:236942780-236942802 CACCCACTTTCAGCTGAGGTTGG + Intergenic
949001646 2:241617944-241617966 CACCCACTGGGACCTGGGGACGG + Intronic
1169343070 20:4810746-4810768 CCCCCACTGGGAGCTGAGGTGGG - Intronic
1169881264 20:10349874-10349896 CACTCACACGTATCTGAAGTTGG + Intergenic
1171156286 20:22877765-22877787 TACCCACTTGGGCCTGAGGTTGG + Intergenic
1172175629 20:32970397-32970419 CACTCGCTCGGTTCTCAGGTGGG + Intergenic
1173778738 20:45735942-45735964 CACCCACTCGGAACTCACGCTGG - Intergenic
1176112748 20:63417974-63417996 CTCCCTCGCAGATCTGAGGTGGG - Intronic
1179492544 21:41750789-41750811 CAGCTACTCGGGACTGAGGTTGG - Intronic
1180957250 22:19746553-19746575 CACTCACCCAGATCTGGGGTCGG - Intergenic
1181942873 22:26492303-26492325 CACCCACACGGAGCGGAGGAAGG - Exonic
1184438969 22:44497433-44497455 CACCAACTCGGCGCTGAGGCGGG - Exonic
1185366993 22:50441347-50441369 CTCCAACTGGGATCTGGGGTAGG - Intronic
952309089 3:32170858-32170880 CAGCTACTCGGGGCTGAGGTGGG + Intergenic
955119198 3:56038914-56038936 CACCCACTGGGGCCTGTGGTAGG + Intronic
955782237 3:62497388-62497410 CAACCACTCAGATCAGAGGAGGG + Intronic
963814257 3:149812645-149812667 CACCCACTCTGATCTCAGACTGG + Intronic
968860877 4:3168762-3168784 CAGCTACTCGGGGCTGAGGTGGG + Intronic
968873231 4:3252089-3252111 CACCCACTCCGAGCACAGGTTGG + Intronic
968915747 4:3496416-3496438 CAGCCGCTCAGCTCTGAGGTCGG + Intronic
978392708 4:108243673-108243695 CACCCTCTGGGACCTGAGATAGG + Intergenic
984331079 4:178319500-178319522 CACTAACTTGGATCTCAGGTTGG + Intergenic
985091609 4:186368534-186368556 CACCCACTGGAATCTGGGCTAGG - Intergenic
985334021 4:188872265-188872287 CAGCTACTCGGGTCTGAGGCAGG + Intergenic
985521974 5:377972-377994 CACCCACTCTGTTCTGGGGGAGG + Intronic
990128674 5:52551730-52551752 CACCCACTTGAATCTGGGCTGGG - Intergenic
998157374 5:139794788-139794810 CACCCACAGGGATCTAAGGAGGG - Intergenic
999245252 5:150150750-150150772 CACCCACTCCCACCAGAGGTAGG + Intronic
1000020405 5:157313566-157313588 CACCCACTCCCAGCTGAAGTCGG - Intronic
1001525135 5:172423525-172423547 CACCCACTTGGATACGGGGTTGG + Intronic
1002310538 5:178311087-178311109 GACCCACACGGCTCTGAGCTAGG + Intronic
1002456565 5:179348573-179348595 CACCCACTGAGAGCTGTGGTGGG - Intergenic
1004709891 6:18159659-18159681 CAACTACTTGGAGCTGAGGTGGG + Intronic
1005311462 6:24563354-24563376 GGCCCACTCGGATCTCAGGTAGG - Exonic
1009661109 6:66612584-66612606 CACCCACTCTGATATCATGTTGG - Intergenic
1024193797 7:47039041-47039063 CACCCACTCTGTGCTCAGGTAGG - Intergenic
1027689154 7:81320237-81320259 CAGCCAGGAGGATCTGAGGTTGG - Intergenic
1030186749 7:106769858-106769880 CAGCTACTCGGGGCTGAGGTGGG + Intergenic
1032462570 7:132122726-132122748 CACCCACGCCGCTCAGAGGTGGG - Intergenic
1033629802 7:143146483-143146505 CTCCCACTTGGATGTTAGGTGGG + Intergenic
1040517863 8:48148952-48148974 CAGCTACTCGGGGCTGAGGTTGG + Intergenic
1041874029 8:62667129-62667151 CACACACTCGGACCTGTTGTGGG + Intronic
1047475195 8:125221355-125221377 CAGCTACTCAGGTCTGAGGTGGG - Intronic
1048031958 8:130641366-130641388 CACCCACTTTGGGCTGAGGTTGG - Intergenic
1050230070 9:3514560-3514582 CACCCCCTCAGGACTGAGGTGGG - Intronic
1052859364 9:33427362-33427384 CATCCACTCCAATCTGGGGTTGG + Intergenic
1056846456 9:90041778-90041800 CTCCCACTCTCATCTGAGGAAGG - Intergenic
1059486860 9:114633773-114633795 CACCAACACGGACCTGAGGCTGG + Exonic
1203774389 EBV:64693-64715 GTCCCACTCGGAGCTGAGGTCGG - Intergenic
1203691629 Un_GL000214v1:47924-47946 CCTCAACTTGGATCTGAGGTTGG + Intergenic
1203644666 Un_KI270751v1:56267-56289 CCTCAACTTGGATCTGAGGTTGG - Intergenic
1191971127 X:66817394-66817416 CACACACTGGGACCTGGGGTTGG + Intergenic
1193787514 X:85777718-85777740 CACCATCTCAGATCTCAGGTGGG - Intergenic
1195813495 X:108859594-108859616 CACCCACTGGGGCCTGTGGTGGG + Intergenic
1196758777 X:119181233-119181255 CACCCACTGGGGTCTGTTGTGGG + Intergenic
1199656910 X:150005523-150005545 CACCCACACGCATCTGAAGATGG - Intergenic
1200405081 Y:2801916-2801938 CACACACTGGGGTCTGTGGTGGG - Intergenic