ID: 1129115265

View in Genome Browser
Species Human (GRCh38)
Location 15:73362074-73362096
Sequence GTGAACAGGAAGAAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 434}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129115265_1129115271 2 Left 1129115265 15:73362074-73362096 CCACCCAGCTTCTTCCTGTTCAC 0: 1
1: 0
2: 5
3: 27
4: 434
Right 1129115271 15:73362099-73362121 CCATCCCAAAAGCCAGCATGCGG 0: 1
1: 0
2: 1
3: 16
4: 179
1129115265_1129115272 3 Left 1129115265 15:73362074-73362096 CCACCCAGCTTCTTCCTGTTCAC 0: 1
1: 0
2: 5
3: 27
4: 434
Right 1129115272 15:73362100-73362122 CATCCCAAAAGCCAGCATGCGGG 0: 1
1: 0
2: 1
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129115265 Original CRISPR GTGAACAGGAAGAAGCTGGG TGG (reversed) Intronic
900110779 1:1004659-1004681 GGGAGCAGGAACAGGCTGGGAGG - Intergenic
900403178 1:2481169-2481191 GAGAACAGGCAGCAGCTGGCAGG - Intronic
900520738 1:3104420-3104442 GTGAACAGGCAGAGGCTGCCCGG + Intronic
900759558 1:4461847-4461869 GTGGCCAGGCAGAAGCAGGGAGG - Intergenic
901221007 1:7583762-7583784 GTGCACAGGAAGACACAGGGGGG + Intronic
902082960 1:13833744-13833766 GTGAACAGGAAGAGAGGGGGTGG + Intergenic
902629622 1:17696938-17696960 GTGACCAGGAGGAGGCTGAGGGG + Exonic
902825888 1:18974036-18974058 GTGAGGAGGAAAAAGATGGGAGG - Intergenic
905386430 1:37607363-37607385 GTGAACAGTGATAAGGTGGGAGG - Intergenic
905531601 1:38683796-38683818 AAGAATAAGAAGAAGCTGGGGGG - Intergenic
906099981 1:43254022-43254044 ATGAGCAAGAAGAAACTGGGAGG + Intronic
906155249 1:43610119-43610141 GTCAAAAGGAAGAAGGAGGGAGG - Intronic
906284423 1:44577357-44577379 GGGAGAAGGGAGAAGCTGGGAGG - Intronic
906534907 1:46545957-46545979 GGGAATAGGCAGCAGCTGGGTGG + Intronic
906549885 1:46655735-46655757 GAGTACAGGAAGAATTTGGGAGG - Intronic
907212921 1:52838604-52838626 GAGAACAGCATGAACCTGGGAGG + Intergenic
907595100 1:55712518-55712540 GTAAACATTCAGAAGCTGGGTGG - Intergenic
907755113 1:57303567-57303589 ATGAACAGGGAGAAGCCAGGAGG + Intronic
907831449 1:58068213-58068235 GTGAAGTGGAGGAAACTGGGTGG + Intronic
908387623 1:63657625-63657647 GTGAAAAGGGAGAAGCAGGGAGG - Intronic
908482093 1:64551245-64551267 GAGAACTGAAAGAAGATGGGAGG - Intronic
909339735 1:74518331-74518353 GTGAACAGTAAGAGGCTATGTGG - Intronic
909504263 1:76370399-76370421 ATGAAAAGGAAAAAGATGGGAGG - Intronic
910189151 1:84576997-84577019 GTGCACAGGAAGAAGACAGGAGG + Intergenic
910218006 1:84861902-84861924 GTTAAAAGAAAGGAGCTGGGAGG - Intronic
910468961 1:87530260-87530282 GTGAACAGGAGGAAGCTCACAGG + Intergenic
910619453 1:89236585-89236607 GAGAACAAGAAAAAGCAGGGTGG - Intergenic
912512984 1:110201076-110201098 GGGAACAGCAAGAAGCTGACTGG - Exonic
914414952 1:147471114-147471136 ATGAACTGCAGGAAGCTGGGGGG + Intergenic
914672499 1:149882155-149882177 GGGAACAGAAAGGAGCTGTGTGG - Intronic
914829518 1:151160535-151160557 GAGATGAGGAAGAAGCTGAGGGG + Exonic
915069240 1:153252430-153252452 GTGACAGGGAAGAAGCTAGGTGG - Intergenic
915496097 1:156283713-156283735 AGGAACAGAAAGAAGGTGGGTGG - Intronic
915980177 1:160415499-160415521 GTGGACAGCAGGAACCTGGGTGG + Intronic
916677373 1:167075240-167075262 GTGAACAGATAGAAGTGGGGTGG + Intronic
916693015 1:167209186-167209208 GTCAACAGGAAGCAGGTGGCTGG + Intergenic
917686763 1:177424242-177424264 GAGAACAGCATGAACCTGGGAGG + Intergenic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
919835270 1:201569013-201569035 GCTAACAGGAAGCAGCCGGGAGG - Intergenic
920046112 1:203133669-203133691 GTGGAGGGGAAGATGCTGGGCGG - Intronic
921104073 1:211958961-211958983 CTGAAGGGGAGGAAGCTGGGAGG + Intronic
921663429 1:217836172-217836194 GTGAGCAGGAAGAATCTGTCGGG + Intronic
923559343 1:235027027-235027049 GTGAAGAGGGAGAACCTGAGAGG + Intergenic
923740916 1:236654455-236654477 GTGAACACGGAGGAGCTGGGGGG - Intergenic
923819603 1:237423625-237423647 GAAAACAGGAAGGAGCTGGATGG - Intronic
924159491 1:241216180-241216202 GGGAACAGGCTGAACCTGGGAGG + Intronic
1062785738 10:263248-263270 GTCAACAGGCAGCAGGTGGGTGG + Intergenic
1064584839 10:16829687-16829709 TGGGACAGGAAGAAGCTGGCTGG + Intronic
1065183655 10:23151202-23151224 GTGAACAGCAAAAAGATGCGCGG - Intergenic
1065424666 10:25587101-25587123 GTCAACAGGAAGCAGGTGGTTGG + Intronic
1065932432 10:30491481-30491503 CTGTGCAGGAAGAAACTGGGTGG + Intergenic
1066156471 10:32683794-32683816 GTGATCAGGCAGAAGTAGGGTGG + Intronic
1067199800 10:44157138-44157160 GGGAACAGCAAGATCCTGGGGGG + Intergenic
1067385477 10:45814436-45814458 GAGAACAGGAAGCAGCTCAGTGG + Intergenic
1067449671 10:46374545-46374567 GAGAACAGGAAGCAGCTCAGTGG - Intergenic
1067587707 10:47486216-47486238 GAGAACAGGAAGCAGCTCAGTGG + Intergenic
1067634825 10:47994320-47994342 GAGAACAGGAAGCAGCTCAGTGG + Intergenic
1068596218 10:58905445-58905467 GTGATCAGGTAGAGGCAGGGTGG - Intergenic
1069290536 10:66773495-66773517 GGGAACAGGAAGAAGCACTGAGG + Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1069548447 10:69345533-69345555 GAGAAGAGGAAGGAGCGGGGAGG + Intronic
1070131799 10:73661066-73661088 GAGAACAGGAAGCAGCTCAGTGG + Intronic
1071121837 10:82287498-82287520 GTGAGCATGAACAAGCAGGGAGG + Intronic
1071610291 10:87025714-87025736 GAGAACAGGAAGCAGCTCAGTGG - Intergenic
1072032130 10:91530951-91530973 GAGAGAAGTAAGAAGCTGGGTGG - Intergenic
1073339288 10:102732830-102732852 GAGACCAGGGAGAAGCTGAGGGG - Intronic
1073452308 10:103617212-103617234 GTGATCCGGAAGAATCTGGAAGG - Exonic
1074799963 10:116990000-116990022 CAGAACAGGCAGAAGCTGGTAGG + Intronic
1075390330 10:122086783-122086805 GAGAAAAGGCAGGAGCTGGGAGG + Exonic
1075618038 10:123905670-123905692 GTGAATAGGGAGAAGCTGCGTGG - Intronic
1076170947 10:128319540-128319562 GTGAAGAGAAAGAAGCTACGTGG + Intergenic
1076929974 10:133525701-133525723 GAGAACAGGAAGCATCAGGGTGG - Intronic
1077110414 11:859741-859763 GAGACCAGGAAGAGGCTTGGGGG - Intronic
1077138891 11:1014852-1014874 GGGAGCAGGAACCAGCTGGGAGG - Intronic
1077185076 11:1232204-1232226 GGGGACAGGAAGGTGCTGGGTGG - Intronic
1077236058 11:1482532-1482554 GTGGACGGGAAGAGGCAGGGAGG - Intronic
1077338636 11:2016434-2016456 GTGGACAGGAAGAGGCTGCAGGG - Intergenic
1077498428 11:2897850-2897872 GTGATCTGGAAGGAGCGGGGAGG - Intronic
1077498443 11:2897919-2897941 GTGACCTGGAAGGAGCGGGGAGG - Intronic
1077503322 11:2919058-2919080 GTGAGCAGGAAGGTGCTGGAAGG - Intronic
1080092581 11:28365958-28365980 GAGAACAGCATGAACCTGGGAGG + Intergenic
1080643988 11:34174864-34174886 GGGAACAGGCAGGAGCCGGGAGG - Intronic
1081393584 11:42558920-42558942 GTGAAGAGGAAGGGGCTGGTGGG - Intergenic
1081540209 11:44029279-44029301 AGGAACAGCAAGAAGCTGGATGG - Intergenic
1081982637 11:47278201-47278223 TTGTAGAGGAAGAAGCTGGCAGG - Exonic
1084043755 11:66557341-66557363 ATGGACAGGAGGAGGCTGGGAGG - Intronic
1084328588 11:68416330-68416352 CTGAACAGCAAGAAGGTGGTGGG - Exonic
1084537241 11:69764406-69764428 GGGTAGAGGAAGAAGTTGGGGGG + Intergenic
1084565145 11:69924313-69924335 GGGAAGAGGACCAAGCTGGGAGG + Intergenic
1085993988 11:81888595-81888617 GTCAACAGGAAGCAGATGGTTGG - Intergenic
1086097974 11:83069568-83069590 GGGAACAGGAAGAAAGAGGGGGG + Intronic
1086856282 11:91869857-91869879 GTGAAACGGAAGAAGCTGACAGG + Intergenic
1087908901 11:103729916-103729938 GTGGAGAGGAAGAAGGGGGGTGG + Intergenic
1088321748 11:108561828-108561850 TTGAACAGGAGGAAGCTATGGGG + Intronic
1088471434 11:110191460-110191482 CTGAACAGGCAAAAGCTGGAAGG + Intronic
1088504299 11:110513670-110513692 GTGGACAGCCAGAGGCTGGGAGG + Intergenic
1088675817 11:112192078-112192100 GTTAACAGGAGGAAGCAGGAAGG - Intronic
1088764496 11:112962583-112962605 GTGAACAATAGGGAGCTGGGAGG + Intronic
1089535090 11:119156225-119156247 GTGAAGGGGATGAAGCTGGCAGG - Intronic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1089769431 11:120792725-120792747 GTTAACAGGAAGAATCTAGGAGG + Intronic
1090404419 11:126468312-126468334 GTCTCCAGGAAGAAGCTTGGAGG + Intronic
1090717769 11:129445252-129445274 CTGACGAGGAAGAAGGTGGGTGG - Intronic
1202821620 11_KI270721v1_random:71616-71638 GTGGACAGGAAGAGGCTGCAGGG - Intergenic
1091379222 12:45194-45216 ATGAGCAGGAAGAGACTGGGAGG + Intergenic
1091693918 12:2615616-2615638 GCCAACAGGATGAGGCTGGGTGG + Intronic
1092627431 12:10342102-10342124 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1093074371 12:14742272-14742294 CTGAAGAGGAATAACCTGGGAGG + Intergenic
1093889980 12:24508321-24508343 GAGAACAGGAATAAGGTAGGGGG + Intergenic
1094023170 12:25935668-25935690 GGAAACAGGAAAGAGCTGGGAGG + Intergenic
1094032178 12:26024865-26024887 GAGAACAGCATGAATCTGGGAGG + Intronic
1094069391 12:26396277-26396299 GAGATCAGGAAGAGGCTGAGAGG - Intronic
1096965181 12:55620546-55620568 GCGAGAAGGAAGAAGGTGGGAGG + Intergenic
1097009115 12:55940055-55940077 GGGAGAAGGAAGAAGTTGGGAGG - Intronic
1097383377 12:58921080-58921102 GTGCACTGGATAAAGCTGGGCGG + Intergenic
1097893382 12:64800555-64800577 GGGAAGAGGAGGAATCTGGGTGG + Intronic
1098079182 12:66765863-66765885 GGAGACAGGAAGAAGATGGGAGG + Intronic
1098558157 12:71842511-71842533 GTGAAGAGGAAGAAGCAAGAAGG + Intronic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1100034773 12:90236899-90236921 GTCAACAGGCAGAAAGTGGGAGG - Intergenic
1100719152 12:97338854-97338876 GAGAGCAGGAAGAAGCTGCAAGG + Intergenic
1100879092 12:98996449-98996471 GTGGAGGGGAAGAATCTGGGTGG - Intronic
1102959268 12:117081601-117081623 TAGAACAGTAAGAAACTGGGGGG + Intronic
1102972100 12:117177051-117177073 GTGAGAAGGAAGAAGTTGAGTGG - Intronic
1103948383 12:124539411-124539433 GTGAGCATGAAGGAGCTGGTGGG - Intronic
1104294268 12:127497357-127497379 GTGCATAGGAAGAAGCTGTGTGG - Intergenic
1104997217 12:132665476-132665498 GTGAAATGGAAGAATCTGTGAGG - Intronic
1105962384 13:25354026-25354048 GTGAGCAGGAAGCAGCAGGGAGG + Intergenic
1106311977 13:28562756-28562778 GGGGACAGAAAGAAGCTGGATGG - Intergenic
1109118322 13:58419511-58419533 ATTAACAGAAAGAAGCTGGAAGG - Intergenic
1109161465 13:58980473-58980495 GTGCACAGGGTGAAGGTGGGAGG - Intergenic
1110139921 13:72115846-72115868 GTGTATAGAAAGAAGCTGGCTGG - Intergenic
1110614969 13:77531259-77531281 GAGAGAAGGAAGAACCTGGGAGG - Intergenic
1111207042 13:85024484-85024506 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1111251058 13:85601860-85601882 GGGAACAAGAAGAAGCTATGAGG + Intergenic
1112073846 13:95886196-95886218 GTTAAGAGTAAGAAGCTGAGGGG + Intronic
1112274127 13:98000193-98000215 GAGAATAGCATGAAGCTGGGAGG + Intronic
1113282121 13:108799860-108799882 GTTAAGAGGAAGAAGAAGGGAGG + Intronic
1113780482 13:112973957-112973979 GAGATCAGGAAGACGCTGGAAGG - Intronic
1114197965 14:20495658-20495680 GGGAAAAGGGAGAAGCGGGGAGG - Intergenic
1114366664 14:22034298-22034320 GTGAACAGGAAGAGGCAGGGAGG + Intergenic
1115199899 14:30841652-30841674 GTGTACATTAAGAAGCTGGGTGG - Intergenic
1115466050 14:33715492-33715514 GGGAACAGGATAAACCTGGGAGG + Intronic
1116084586 14:40218438-40218460 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1116350150 14:43851208-43851230 GAGAACAGCATGAACCTGGGAGG + Intergenic
1118151803 14:63197426-63197448 GTGAACTGGGAGACACTGGGAGG - Intergenic
1118698857 14:68413199-68413221 GTCAACAGGAAGTAGCTGGTAGG + Intronic
1118821808 14:69350696-69350718 GTGGACAGGGAGCAGCTGAGGGG - Intronic
1119535433 14:75399344-75399366 GGGAAAAAGAAGTAGCTGGGTGG + Intergenic
1119655322 14:76413307-76413329 GGGCACAGGAAGAAGCCAGGTGG - Intronic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1119894378 14:78207307-78207329 GTGCGCAGGAAGAAGGTGGGTGG - Intergenic
1120963960 14:90151007-90151029 GTGAACAGGAGGAAGAAGGGAGG - Intronic
1121144610 14:91573622-91573644 GTGAGAAGGAAGAGGCTGGCAGG + Intergenic
1121658222 14:95614250-95614272 GTGGGCAGGAAGAACCTGTGTGG - Intergenic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1122037250 14:98957716-98957738 GTGGACAGGAAGAAGCTGGCCGG + Intergenic
1123672832 15:22677623-22677645 GAGAACAGCATGAACCTGGGAGG - Intergenic
1124324886 15:28750912-28750934 GAGAACAGCATGAACCTGGGAGG - Intergenic
1124528735 15:30483936-30483958 GAGAACAGCATGAACCTGGGAGG - Intergenic
1124769921 15:32523760-32523782 GAGAACAGCATGAACCTGGGAGG + Intergenic
1124855336 15:33382126-33382148 GGGAACTGCAAGAAGCTTGGTGG + Intronic
1127824799 15:62693508-62693530 GTGGAGAGGAAGATGCTGAGGGG - Intronic
1128736893 15:70058558-70058580 GTGGAGTGGGAGAAGCTGGGTGG - Intronic
1129115265 15:73362074-73362096 GTGAACAGGAAGAAGCTGGGTGG - Intronic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130318841 15:82822525-82822547 GAGAACAGCATGAACCTGGGAGG - Intronic
1130830426 15:87593030-87593052 GTGAAAGGGAAGAAGATGGTGGG + Intergenic
1130904112 15:88227930-88227952 GTGAACATGAAGAAGGGAGGAGG - Intronic
1131099537 15:89677379-89677401 GGGAGGAGGAAGAAGCAGGGAGG - Intronic
1132097170 15:98995821-98995843 GTGAAGAGGAGGAAGGTGGTGGG - Intronic
1132369915 15:101288739-101288761 TTGTACAGGAAGAAGCAGAGGGG + Intronic
1132862565 16:2078831-2078853 GAGAACGGGGAGACGCTGGGTGG - Intronic
1133507129 16:6423134-6423156 GTGAACAGCAGCAACCTGGGAGG - Intronic
1133553331 16:6880605-6880627 GTGAACTGGAAGAGGCAGGGTGG + Intronic
1133931593 16:10237152-10237174 CTGAGCAGGGAGAATCTGGGAGG - Intergenic
1134267055 16:12701569-12701591 GTGAACCAGAAGAGGCTGGAGGG + Intronic
1134631728 16:15760977-15760999 GAGAAAAGCAAGATGCTGGGAGG - Intronic
1135916668 16:26611094-26611116 GTGGATAGGAGGAAGTTGGGAGG - Intergenic
1136233843 16:28902976-28902998 GTGAGGAGGAAGGAGGTGGGCGG - Intronic
1136393727 16:29981626-29981648 GTGAAAGGGAAGAAGGTGAGAGG - Intronic
1136590826 16:31216664-31216686 GGGAACAGGAAGGCTCTGGGCGG + Intronic
1138003455 16:53306867-53306889 GTGAACTGCATGAACCTGGGAGG - Intronic
1138331395 16:56218636-56218658 GGGCAAGGGAAGAAGCTGGGTGG - Intronic
1139173658 16:64662298-64662320 GAGAAAAGGAAGAAGTAGGGAGG - Intergenic
1140623870 16:76769322-76769344 GTGAACAGGTGTCAGCTGGGTGG + Intergenic
1142111627 16:88335049-88335071 GGGCACAGGAAGAGGCAGGGAGG + Intergenic
1142522143 17:512523-512545 GTGAGAAGGAAGGAGCTGGCAGG + Exonic
1142994110 17:3750903-3750925 GAGAGGAGGAGGAAGCTGGGTGG + Intronic
1143400468 17:6639537-6639559 GTGGACAGGGACAGGCTGGGAGG - Intronic
1144333628 17:14248764-14248786 GTAACCAAGAAGAAGGTGGGAGG - Intergenic
1145934221 17:28705573-28705595 GGGCACAGGAAGAAGCTGCTGGG + Intronic
1147200907 17:38800196-38800218 GAGAACAGGCAGCAGGTGGGTGG - Intergenic
1147702868 17:42406816-42406838 GGAAAGAGGAAGAAGCTGGCTGG + Intronic
1147967778 17:44202792-44202814 GTAAACAGGGAGAAGCCAGGAGG - Intergenic
1148165115 17:45478125-45478147 GTCATCAAGAAGAAGCTGGTGGG - Exonic
1148206432 17:45783189-45783211 CTGAAAAGGGAGAAACTGGGAGG - Intergenic
1148583561 17:48760645-48760667 GTGAACAGACAGGAGGTGGGTGG + Intergenic
1148634149 17:49134097-49134119 CTGAAAAGGAGGAAGCTGGGAGG + Intronic
1148892188 17:50816361-50816383 GAGACAAGGAAGAAGCGGGGAGG - Intergenic
1149209786 17:54289458-54289480 GAGAACAGCATGAAGCCGGGAGG + Intergenic
1149380503 17:56088650-56088672 GAGAACAGGAGGAAGATAGGTGG - Intergenic
1149538144 17:57448409-57448431 ATGAACAGGAAGATGGTGTGTGG + Intronic
1149978694 17:61291921-61291943 GTGAGGAGGAAGAGGGTGGGAGG + Intronic
1150306903 17:64093366-64093388 GGGGCCAGGAAGAAACTGGGAGG - Intronic
1150396346 17:64824850-64824872 GTCATCAAGAAGAAGCTGGTGGG - Intergenic
1150544343 17:66138249-66138271 GTCAACAGGAAGCAGGTGGTTGG + Intronic
1150686422 17:67324745-67324767 GTAAAGAGTAAGAAGCCGGGGGG + Intergenic
1152008478 17:77696724-77696746 ATGGACAGGAAAAAGCAGGGGGG + Intergenic
1152046413 17:77939143-77939165 GTGAACATGAAGACACAGGGAGG + Intergenic
1152629159 17:81402053-81402075 GGGATCAAGAAGAAGCAGGGAGG - Intronic
1152925256 17:83084717-83084739 GTGCACTGGAAGGAACTGGGTGG + Intronic
1153442564 18:5136862-5136884 ATGAAGAGGCAGAAGCTTGGTGG + Intergenic
1153523734 18:5976456-5976478 GGGTGCAGGAAGAGGCTGGGTGG + Intronic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1153886922 18:9475538-9475560 GTAAACAGGCAGAGGCTGGGCGG + Intronic
1154111051 18:11568688-11568710 GGGATCAGGAGGAAGCTGCGCGG - Intergenic
1154230865 18:12555016-12555038 GTCAACAGGAAGTAGGTGGTCGG - Intronic
1155775981 18:29762130-29762152 GAGAAGAGAAAGAAGCAGGGAGG - Intergenic
1156461569 18:37324153-37324175 GTCAAGAGGAGGAGGCTGGGAGG - Intronic
1157441126 18:47712512-47712534 GTGAACAGGATGCAGAGGGGTGG - Intergenic
1157538832 18:48484158-48484180 GGCAACAGGCAGAAGCTGGAAGG + Intergenic
1160708687 19:540952-540974 GAGCAAAGGAAGCAGCTGGGAGG - Intronic
1160814429 19:1028661-1028683 GTGAACAGGAATGTGCTGGAAGG + Intronic
1161110891 19:2469423-2469445 GTGCACAGCAAGAGGCTGGCAGG - Intergenic
1161698352 19:5782570-5782592 GGGGACAGGAGGCAGCTGGGTGG + Intergenic
1162326057 19:10000347-10000369 GTGACCTGGAGGAAGATGGGAGG - Intronic
1163758699 19:19121407-19121429 GTGTGCAGGAGGAACCTGGGGGG + Exonic
1164265380 19:23610925-23610947 GAGAACAAGAAAAAGCAGGGTGG - Intronic
1164912513 19:32024628-32024650 GTGAACTTGAAGAAGCAAGGAGG - Intergenic
1165143342 19:33715881-33715903 TCAAACAGGAATAAGCTGGGAGG + Intronic
1165212483 19:34247035-34247057 GAGAAGAGGTTGAAGCTGGGAGG - Intergenic
1165381538 19:35484974-35484996 GAGTACAGGAAGAAGAGGGGAGG - Intergenic
1165726386 19:38115742-38115764 TTGGACAGGGAGAATCTGGGAGG - Intronic
1166492200 19:43269401-43269423 GTGTGCAGGAAGGGGCTGGGAGG + Exonic
1166696059 19:44851953-44851975 GGTGACAGGGAGAAGCTGGGAGG - Intronic
1167006376 19:46778747-46778769 GTGAAGAGGAAGTAGATGAGGGG + Exonic
1167472948 19:49685590-49685612 GTGAGCCGGGTGAAGCTGGGTGG + Intronic
1167645501 19:50703179-50703201 CTGAACAGGAAGAGGATGGGGGG - Intronic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925008841 2:467305-467327 GTGAACAGGAGGAGGCTTTGGGG - Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
926859897 2:17298645-17298667 GTGAGAAGGAAGGAGATGGGAGG - Intergenic
927207804 2:20621083-20621105 ATGAACAGGAAGAACCAGGCAGG + Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
928696141 2:33852087-33852109 GTCAACAGGAAGCAGGTGGTCGG + Intergenic
929366304 2:41160434-41160456 GTGAACAGGAGGAAGGTGCTTGG + Intergenic
930304940 2:49665863-49665885 GTGATCAGGCAGAAGCAGAGTGG + Intergenic
933514606 2:83284449-83284471 ATGTACTGGAGGAAGCTGGGGGG - Intergenic
934563047 2:95323101-95323123 GTGAACAGGAACACTATGGGAGG + Intronic
934862331 2:97774677-97774699 GTGAGCAGGAAGAGGCTGGCAGG + Intronic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
935587600 2:104815832-104815854 GTGAGCAGGAAGGAGCTTAGGGG - Intergenic
936109780 2:109655478-109655500 ATGCACAGGAAGAGGATGGGAGG + Intergenic
936564481 2:113572392-113572414 ATGAGCAGGAAGAGACTGGGAGG - Intergenic
936937280 2:117850478-117850500 GTGAAAAGAAAGCAGCTGGCAGG + Intergenic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
937891064 2:126939419-126939441 GTGTTCAGGAAGAAAATGGGAGG - Intergenic
938404808 2:131025530-131025552 TTGAACAGATGGAAGCTGGGAGG - Intronic
940493056 2:154389871-154389893 GTCAACAGGAAGCAGTTGGTTGG + Intronic
940780180 2:157924994-157925016 AAGAAAAGGAAGAAGCTGGTGGG - Intronic
942692089 2:178596393-178596415 TTGGACAGGAGGGAGCTGGGAGG + Intronic
943283533 2:185967526-185967548 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
943434243 2:187844165-187844187 ATGAACAAGAAGAAACTGTGGGG - Intergenic
944300011 2:198112899-198112921 ATTACCAGGAAGAAGGTGGGTGG + Intronic
945955800 2:216084731-216084753 GGGCACAGGAAGAGGCGGGGTGG + Intronic
947581082 2:231319021-231319043 GGGAACAGGAAGAAGCAGGGAGG + Intronic
948255272 2:236563863-236563885 GTGATCAGGAAGTATCTGAGGGG + Intergenic
948737147 2:240016604-240016626 GTGCACAGGAGGAAGCAGAGGGG - Intronic
1169331520 20:4720327-4720349 GGGAATAGGAAGAAGAGGGGTGG + Intergenic
1170329517 20:15193123-15193145 GAGAAGAGAAAGAAGATGGGAGG - Intronic
1170776317 20:19377778-19377800 GTGAACAGGAAAAGGCTGGGTGG - Intronic
1170918782 20:20655684-20655706 GTGAACTGGAGGCAGCTGAGAGG + Intronic
1171163613 20:22951395-22951417 GCAAAGAGGAAGAAGATGGGAGG + Intergenic
1171350867 20:24502143-24502165 GGGAACAGAAAGAAGGTGAGGGG - Intronic
1172031495 20:31985177-31985199 GTGAACAGGGTGGGGCTGGGAGG - Intronic
1172232103 20:33343722-33343744 GGGAACAGGAGAAATCTGGGAGG - Intergenic
1173649289 20:44652676-44652698 GTGAAAGGGAAGGAGCCGGGAGG + Intergenic
1174109132 20:48185797-48185819 GTGCAAAGGAAGAGGCTGGGTGG - Intergenic
1174512495 20:51064720-51064742 GTGAAAGGGAAAAAGATGGGAGG - Intergenic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175895276 20:62333229-62333251 GTGTAGAGGAGGCAGCTGGGGGG + Exonic
1177932660 21:27303994-27304016 GTGAAAAGGATGAAGCTGCCTGG + Intergenic
1178370093 21:32020341-32020363 GTGAACTTGAAGGAGCAGGGAGG + Intronic
1181064237 22:20298292-20298314 GTGCACAGGGAGAAGCAGGTGGG + Intergenic
1181406728 22:22690228-22690250 GTGGACAGGGGGAAGCTGGTTGG + Intergenic
1181528855 22:23504703-23504725 GAGGAGAGGCAGAAGCTGGGAGG + Intergenic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1184647501 22:45904018-45904040 GTGAACAGGGAGGAGCATGGTGG + Intergenic
1184974411 22:48050957-48050979 GTGCAGAGGAAGAAGCCAGGGGG + Intergenic
1185048235 22:48539896-48539918 GGGTACAGGCAGAAGGTGGGAGG + Intronic
949104096 3:182534-182556 GTGAACAGGAGGAAGTTGACAGG - Intergenic
950134785 3:10573413-10573435 GTGAACAGGAAGTAGAGGTGGGG - Intronic
952885656 3:38009768-38009790 CTGAAGGGGAAGAAGCTCGGGGG - Exonic
952925499 3:38316701-38316723 GGGAACTGGCAGAGGCTGGGTGG - Intronic
953167839 3:40481487-40481509 AAGACCAGAAAGAAGCTGGGTGG + Intronic
953380337 3:42466356-42466378 GAGAACAGCATGAACCTGGGAGG - Intergenic
953405888 3:42659527-42659549 CTGAACCTGAAGAAGCTGGGCGG + Exonic
954172907 3:48819642-48819664 TTCCACAGGAAAAAGCTGGGGGG - Intronic
954430257 3:50467035-50467057 GTGGACTTGAAGAAGCTGAGTGG + Intronic
954892720 3:53946116-53946138 GTCAACAGGAAGCAGGTGGTGGG - Intergenic
955123461 3:56085296-56085318 GTGAGAAGGATGAAGCTGGGAGG + Intronic
955265873 3:57444109-57444131 GAGAACAGGTTGAACCTGGGAGG + Intronic
956067777 3:65415195-65415217 GTGAAAAGGAAGAGCCTGGAAGG - Intronic
957011317 3:75008953-75008975 GAGAACAGTATGAACCTGGGAGG + Intergenic
960389187 3:117056032-117056054 GTAAACAGAAAGGAGATGGGGGG - Intronic
961345349 3:126260327-126260349 GTGAAGAGAAAGAAGCGAGGAGG - Intergenic
962436430 3:135371429-135371451 GGGAACAGGAGGGAGGTGGGTGG - Intergenic
962611568 3:137081550-137081572 AGAAACAGGAAGAAGTTGGGGGG + Intergenic
963854457 3:150239233-150239255 GTGGACAGGAAGGAAGTGGGAGG + Intergenic
963899533 3:150720573-150720595 AGGAACAGGAAGAGACTGGGGGG + Intergenic
966473937 3:180322892-180322914 GTAAACAGGCGGAGGCTGGGCGG + Intergenic
966523129 3:180894664-180894686 GTGAAAAGGAAGAAAAGGGGGGG - Intronic
967444414 3:189548678-189548700 GTCAACAGGAAGAGGTTGGCTGG + Intergenic
967956963 3:194884773-194884795 GTGAATAGGATGCAGCTGGGTGG + Intergenic
969881660 4:10179212-10179234 GGGAAAAGGTAGAGGCTGGGAGG + Intergenic
970627247 4:17900763-17900785 GTGAAAAGGAAGAGGTAGGGAGG + Intronic
971382476 4:26111401-26111423 GTGAAGAGTAAGAAGCTGTTGGG - Intergenic
972558047 4:40200072-40200094 GTGCACAGGTGGAGGCTGGGAGG + Intronic
972648945 4:40997081-40997103 GTCAACAGGAAGCAGGTGGTTGG - Intronic
973295723 4:48518606-48518628 GTGAACAAGAAGGAGAGGGGTGG - Intronic
973662095 4:53118774-53118796 GTTAAAAGGCAGAAGCAGGGAGG - Intronic
973828930 4:54738523-54738545 GTGCACAAGCAGAGGCTGGGAGG - Exonic
974538501 4:63200882-63200904 GGGAACAAGATGTAGCTGGGAGG - Intergenic
976013866 4:80525754-80525776 GTGAGCTGGAAGAAGTTGAGGGG - Intronic
976813835 4:89124374-89124396 GTGGGGAGAAAGAAGCTGGGTGG - Intergenic
977039729 4:92001637-92001659 GAGAGCAAGAAGAAGCAGGGTGG + Intergenic
977262911 4:94819471-94819493 GTGTCCAGGAAGGAGCTGTGTGG + Intronic
981185872 4:141802485-141802507 GTGAACTGGAATAATATGGGAGG + Intergenic
981842425 4:149127979-149128001 GTGAAATGGGAGAAGCTGGAAGG + Intergenic
982061690 4:151610753-151610775 CTGATCAGGAAGAATCTGGGAGG - Intronic
982783382 4:159514308-159514330 GAGAACAGCATGAACCTGGGAGG - Intergenic
982821276 4:159943114-159943136 GTGAAAAGGTAGATACTGGGAGG + Intergenic
983004149 4:162461856-162461878 GTGAACATGACTTAGCTGGGTGG - Intergenic
983238089 4:165202725-165202747 ATGGACAGGCAGAAGCTGTGGGG + Intronic
983595852 4:169466999-169467021 CTGAAGAGGAGGAAGTTGGGGGG - Intronic
984084730 4:175294680-175294702 GTGTACAGAAAGAAGCTGTTTGG - Intergenic
984502510 4:180574038-180574060 GGCAAAAGGAAGAAGCAGGGAGG + Intergenic
984655514 4:182313563-182313585 GTGAACACCAAAAAGCTAGGAGG + Intronic
985120091 4:186631498-186631520 GAGCACAGGAATCAGCTGGGAGG - Intronic
986243590 5:5984065-5984087 GTGAATAGGTAGACGTTGGGAGG - Intergenic
986481483 5:8192974-8192996 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
988522973 5:31962852-31962874 GTGATCTGGAAGAATCTGGAAGG - Intronic
988982656 5:36587015-36587037 GTGAAGGGGAAGAGGCTTGGAGG - Intergenic
990011007 5:50997735-50997757 GTGAAGAGGAAGGAGAGGGGAGG - Intergenic
992415019 5:76544125-76544147 GGGAACAGGAAGATGATGAGAGG - Intronic
992541846 5:77773787-77773809 GCGAACAGGAAGAAGCCAGTTGG + Intronic
992959614 5:81945831-81945853 GTGAACAAGAAGAACCTGTTGGG - Intergenic
992991461 5:82287926-82287948 GTGAGCATGAAGAAGCAGTGAGG + Intronic
995055543 5:107754747-107754769 GATAACAGGAAGGAGATGGGAGG - Intergenic
995702230 5:114949169-114949191 TTGAACAGGAAGAACTTGGGAGG - Intergenic
997233779 5:132261022-132261044 ATGAAGAGAAAGAAGCTTGGGGG - Intronic
997269690 5:132526374-132526396 GTGAGGAGCAAGAAGCTGCGAGG + Intergenic
997896293 5:137720587-137720609 GTGAACAGGAAGGAAGAGGGAGG + Intronic
998372739 5:141671864-141671886 GCGAAGAGGGAGAAGGTGGGAGG - Intronic
998893213 5:146768759-146768781 AGGAACAGGAAAGAGCTGGGAGG - Intronic
1000537097 5:162492770-162492792 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1001199157 5:169700022-169700044 GTGACCATGAAGATGCTGGTGGG + Exonic
1001925046 5:175630124-175630146 CTGAACAGGAACAGGCTGGAGGG - Intergenic
1003356062 6:5371578-5371600 GTGAACAGTAATAAATTGGGGGG + Intronic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1004370106 6:15044890-15044912 GGGAAAAGGAAGATGGTGGGGGG - Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006881022 6:37339970-37339992 GTGGTCAGAAAGAAGTTGGGAGG - Intergenic
1007241960 6:40432701-40432723 GTGAACAACAACCAGCTGGGCGG - Exonic
1007379741 6:41480655-41480677 GAGAACGGGGAGAACCTGGGAGG - Intergenic
1007756354 6:44102160-44102182 GTGGGCAGGAAGAAGCTGGGTGG - Intergenic
1007935798 6:45730767-45730789 GTGAAGAGGAAGAAGAAAGGGGG - Intergenic
1008702432 6:54117302-54117324 GAGAACAGCATGAACCTGGGAGG - Intronic
1008897951 6:56579556-56579578 GTTAACAGGAAAAAAATGGGAGG + Intronic
1010989887 6:82468911-82468933 GTCAACAGGAAGCAGGTGGTTGG - Intergenic
1011102173 6:83735125-83735147 GAGAACAGCATGAACCTGGGAGG - Intergenic
1013921147 6:115405384-115405406 ATGAACAGAAAAAAGCTGAGTGG - Intergenic
1015861221 6:137682289-137682311 ATGAGCAGGATGAAGCTGTGAGG + Intergenic
1015929308 6:138341305-138341327 CTGAAGAGGAAGCAGCTGGTTGG + Exonic
1016733757 6:147453564-147453586 GTGCACAGGATGCATCTGGGAGG - Intergenic
1016843649 6:148548868-148548890 GTGTACTGGTAGAGGCTGGGAGG + Exonic
1017492164 6:154954366-154954388 TTGTACAGGAAGCAGCTGAGTGG - Intronic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1017678271 6:156837720-156837742 GTGCAGAGGAAGAAGATGGGTGG + Intronic
1018288483 6:162265701-162265723 GTGAACAGGTAGAAGCTTTCTGG - Intronic
1019489821 7:1307079-1307101 TTTAACAGGAAGATGCTGGTGGG + Intergenic
1020154184 7:5708956-5708978 GAGAACAAGAGAAAGCTGGGTGG - Intronic
1020210880 7:6157485-6157507 GAGAACAGCATGAACCTGGGAGG - Intronic
1020601962 7:10286792-10286814 GTGATTAGCAAGAAGTTGGGCGG - Intergenic
1021834595 7:24656830-24656852 GTGGACACAAAGAAGCTGGGAGG - Intronic
1021953789 7:25803210-25803232 GTGATCAGGAAGGTACTGGGTGG + Intergenic
1022149542 7:27586985-27587007 GTGACCATGCAGCAGCTGGGTGG - Intronic
1022402743 7:30056030-30056052 GAGAACAGCATGAACCTGGGGGG - Intronic
1022612953 7:31895299-31895321 CTGAACAGGGACAAGCTGGTGGG + Intronic
1024035512 7:45504712-45504734 GTGGGCAGGAAGAAGCTGCCAGG + Intergenic
1024131784 7:46360834-46360856 GAGGACAGGAAGAAGCCAGGAGG + Intergenic
1026916049 7:74120994-74121016 GTGATGGGGAAGAAGCTCGGGGG - Exonic
1027602847 7:80260508-80260530 GTGAATAGGAAGAAGGAGTGTGG + Intergenic
1029127283 7:98303366-98303388 GTGAAGGGGAGGAGGCTGGGTGG - Intronic
1031112101 7:117623370-117623392 GTGCACAGGAAGCAGCAGGCTGG + Intronic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1032472721 7:132190092-132190114 GGGAGAAGGAAGAAGGTGGGTGG - Intronic
1034180174 7:149130938-149130960 GTCAACAGGAAGCAGGTGGTGGG + Intronic
1034672575 7:152869593-152869615 GTCAACAAGAAGCTGCTGGGAGG - Intergenic
1034732540 7:153400505-153400527 GTGAACAGGGAAAAGCAGAGAGG - Intergenic
1036213334 8:6860242-6860264 GTGGACAGGGAGGAGCAGGGAGG + Intergenic
1036653879 8:10663017-10663039 GGGAGGAGGATGAAGCTGGGTGG + Intronic
1037676044 8:21051457-21051479 ATAAATAGGAAGAAGCTGGAAGG + Intergenic
1037907244 8:22722860-22722882 GAGAACAGCATGAACCTGGGAGG - Intronic
1038247684 8:25874344-25874366 AAGAACAGGCAGCAGCTGGGAGG - Intronic
1038316165 8:26486132-26486154 GGGACCAGCCAGAAGCTGGGGGG - Intronic
1038416968 8:27404215-27404237 GTCAACTGGAGGAAGCTGGAGGG - Intronic
1039094854 8:33872467-33872489 GGGGAAAGGAAGAAGGTGGGAGG + Intergenic
1039269748 8:35867948-35867970 GTTAACAGGAAGCAGGTGGTTGG + Intergenic
1040079562 8:43274023-43274045 GTGCCCAGGCAGAAGCTGGGAGG - Intergenic
1040900448 8:52412464-52412486 GTGAACATGAAGTAATTGGGGGG + Intronic
1041111749 8:54489418-54489440 CTGAACAGGAAGAAGGAAGGAGG + Intergenic
1042520597 8:69707478-69707500 ATGGAAAGGAAGCAGCTGGGAGG + Intronic
1042790041 8:72595170-72595192 GTGGGCAGGTAGAAGCTTGGGGG - Intronic
1043734401 8:83725197-83725219 GTGAACAGGAGTCAACTGGGTGG - Intergenic
1044859617 8:96509876-96509898 GAGAAAAGGAAAAAGCTGGAAGG - Intronic
1045314812 8:101034327-101034349 GTGAACAGCAGGAACCTGGGAGG + Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1047671301 8:127149963-127149985 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1047871773 8:129091103-129091125 GCGGACAGGAAGAATCGGGGAGG - Intergenic
1047914841 8:129571962-129571984 GTGAACAGAGTGAAGCTGTGAGG - Intergenic
1048542787 8:135357869-135357891 GGAAACAGGAAGAGGCAGGGAGG + Intergenic
1048621092 8:136133645-136133667 GTGAATAGGAAGAAGCAATGAGG - Intergenic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1049887939 9:40816-40838 ATGAGCAGGAAGAGACTGGGAGG + Intergenic
1050180385 9:2916617-2916639 GGGAGCAGGAGGAAGCTGGCAGG - Intergenic
1051043940 9:12850790-12850812 GTTATGAGGAAGAAGCTGTGTGG + Intergenic
1051247566 9:15126919-15126941 GTGATCAGGAAGAACCTGATGGG - Intergenic
1051248752 9:15138004-15138026 GTGATCAGGAAGAACCTGATGGG - Intergenic
1051709180 9:19912605-19912627 GTGAATAGGACAAATCTGGGAGG - Intergenic
1051924743 9:22310312-22310334 GTGAGCAGGAAGAAACTGCTAGG - Intergenic
1053137811 9:35662660-35662682 GTGAAGAGGAAGAACATGCGGGG + Exonic
1053274257 9:36771303-36771325 GTGAAGAGGCACGAGCTGGGAGG + Intergenic
1057204660 9:93164087-93164109 GTGTCCAGGGAGAAGCTGGATGG - Intergenic
1057825737 9:98371013-98371035 GGGTACAGGAAGAGGCTGGAAGG - Intronic
1057938868 9:99263128-99263150 GTCATCAGGAGGAAGCTGGAGGG + Intergenic
1059422319 9:114199979-114200001 GGCAACAGGAGGGAGCTGGGGGG - Intronic
1061510274 9:131056849-131056871 GTGAACAGGAAGGTTTTGGGGGG + Intronic
1061588448 9:131583376-131583398 TTGAACAAGAAGACCCTGGGTGG + Intronic
1061855085 9:133437664-133437686 ATGCAAAGGATGAAGCTGGGTGG + Intronic
1062046718 9:134427741-134427763 GTGATCAGCAAGAAGTTGGTGGG - Intronic
1062442780 9:136578632-136578654 GTGACAAGGAAGAGGCTGGAAGG + Intergenic
1185677594 X:1861325-1861347 GAGAACGGGAGGAAGCTGAGGGG - Intergenic
1185847865 X:3456676-3456698 GAGAACAGGCACAGGCTGGGGGG - Intergenic
1187081698 X:15996707-15996729 TTGAGAAGGGAGAAGCTGGGAGG - Intergenic
1188056787 X:25550572-25550594 GTATAGAGGAAGAAGCTGAGTGG + Intergenic
1188173996 X:26965256-26965278 GGGAATGGGAGGAAGCTGGGAGG + Intergenic
1189300465 X:39948676-39948698 GTGACCAGGAAGAAGGGGAGGGG + Intergenic
1190142536 X:47860770-47860792 GTGAACATGGAGGTGCTGGGTGG + Intronic
1193468042 X:81870197-81870219 GTGAACAGGAATTTCCTGGGTGG - Intergenic
1194193411 X:90864786-90864808 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1195880336 X:109586529-109586551 GAGAACAGGAGGGAGGTGGGTGG - Intergenic
1196394435 X:115244163-115244185 GGGACAAGGAAGAAGCTGGAAGG + Intergenic
1196722127 X:118864307-118864329 GTGAACTGGCAGGTGCTGGGTGG + Intergenic
1196815459 X:119662067-119662089 CTGAACAGGAATAAGCTGACAGG - Intronic
1196839139 X:119842089-119842111 TTCAACTGGAAGAAGTTGGGGGG + Intronic
1197179354 X:123517657-123517679 GTCAACAGGAAGCAGGTGGTTGG + Intergenic
1198558839 X:137826098-137826120 ATGAACTGGAGGAAGCAGGGAGG + Intergenic
1198750240 X:139931880-139931902 GTGAAAAGGAAGAAGAGGGGTGG + Intronic
1199559844 X:149150954-149150976 GTGAAGAGCAAGAGGGTGGGGGG + Intergenic
1199743794 X:150759213-150759235 GTGAAGAGGAAGGTGCTGGAAGG - Intronic
1200271379 X:154687542-154687564 GAGAACAGCATGAACCTGGGGGG + Intronic
1200540022 Y:4447173-4447195 GAGAACAAGAAAAAGCAGGGTGG + Intergenic
1201978985 Y:19886716-19886738 GAGAATAGGATGAACCTGGGAGG + Intergenic