ID: 1129116107

View in Genome Browser
Species Human (GRCh38)
Location 15:73366316-73366338
Sequence GAGTTTGCAAAGAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129116100_1129116107 -10 Left 1129116100 15:73366303-73366325 CCCAGCTTCCCTGGAGTTTGCAA 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129116107 Original CRISPR GAGTTTGCAAAGAGGGCTCT GGG Intronic
900139923 1:1135307-1135329 GGGATCCCAAAGAGGGCTCTTGG + Intergenic
901132337 1:6969827-6969849 GAATTTGCAAAGAGAGTTCAGGG + Intronic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
904108360 1:28105340-28105362 AAGTTTGCAAACAAAGCTCTTGG - Intergenic
904379249 1:30100328-30100350 GAGTGTGCAAAGAGAGCCCGTGG + Intergenic
906000012 1:42416579-42416601 CAGTTTCTAAAGAGGGTTCTAGG + Exonic
906775347 1:48524394-48524416 GAGTCTGAAAAGGGGGTTCTTGG + Intergenic
913138409 1:115915272-115915294 GAGTTTCCACAGTGGGCTGTTGG - Intergenic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
914430801 1:147619229-147619251 GAGTTTGTAAGGAGCGCTCCCGG - Exonic
915073042 1:153288213-153288235 GAGTTTAAAAAGAGAGCTCAAGG + Intergenic
920224243 1:204426505-204426527 GACTTTGCAAAGAGTGCTCAGGG - Intronic
924009990 1:239654267-239654289 GAGTTTCCAAAGAAGCTTCTTGG - Intronic
1066238500 10:33510402-33510424 GATTTTGCCAAGAAGGCTTTTGG + Intergenic
1067109188 10:43387376-43387398 GAGTTAGCTGAGAAGGCTCTAGG - Exonic
1067775602 10:49162898-49162920 GGGTTTTCACACAGGGCTCTTGG - Intronic
1067859879 10:49834996-49835018 GACTTTCCAAAGAGGGCTCAGGG - Intronic
1069905229 10:71728293-71728315 TAGTTTGCATAGTGGGTTCTGGG + Intronic
1073102188 10:101012137-101012159 GAGGTTGCAGAGAGGGCTTGGGG - Intronic
1074417290 10:113278295-113278317 GAGTTTGCAAAGGGTGGTCCTGG - Intergenic
1075382580 10:122031240-122031262 GAGATTCAAAAGATGGCTCTGGG + Intronic
1075541485 10:123317904-123317926 GAATTTGCAGACTGGGCTCTGGG - Intergenic
1076720438 10:132390026-132390048 GAGTTTGCAGGGAGGCCCCTGGG + Intergenic
1078083374 11:8219381-8219403 GAGTCTGCAAAGAGAGCCCCAGG - Intergenic
1081997933 11:47376868-47376890 GAGCTTGCAGAGAGGGCTGGGGG + Intronic
1083236385 11:61353545-61353567 AAGTTAGCAGAGAGGGCTCTGGG + Intronic
1084089477 11:66870629-66870651 GACTCTGGAAAGTGGGCTCTAGG - Intronic
1084584955 11:70053809-70053831 GTTTTTGCAAAGAGAACTCTAGG - Intergenic
1088141290 11:106620119-106620141 GAGTTTGCAAAAAGTGCTTTAGG - Intergenic
1088748321 11:112822909-112822931 GAGAGTGCAAAGGGGGCTCCAGG - Intergenic
1089575109 11:119436677-119436699 GAGCTTGGAATGGGGGCTCTAGG - Intergenic
1090020060 11:123120414-123120436 GAGTTTGTCAAGAGATCTCTTGG + Intronic
1090592763 11:128290503-128290525 GAGTTTGCAAGGGGGGCTGCCGG + Intergenic
1090598504 11:128345130-128345152 GAGTTTGAAAAGATGTTTCTAGG - Intergenic
1091361454 11:134981348-134981370 GTGTCTGGAAAGAGGGATCTGGG - Intergenic
1092702196 12:11244272-11244294 GACTTTGTAAATAGGACTCTTGG + Intergenic
1092711830 12:11346274-11346296 GACTTTGTAAATTGGGCTCTTGG + Intergenic
1094123179 12:26995474-26995496 GTGTTTGAAATTAGGGCTCTTGG - Intronic
1095650855 12:44607242-44607264 CATTTTGCAAAGATGGCTGTAGG - Exonic
1096697894 12:53362288-53362310 GAGGTTGCAATGGGGGCTCCTGG + Intergenic
1102182483 12:110922948-110922970 GAGTCTGCAAAGGGGGCTCCAGG + Intergenic
1106639169 13:31564931-31564953 GAGGATCCAAAGATGGCTCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107098262 13:36560071-36560093 TAGTTTGCAAGAAGAGCTCTGGG - Intergenic
1108711263 13:53034769-53034791 GGGTTTGCAAGGAGAGCTCAAGG - Intronic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1114215156 14:20652552-20652574 GAGTTTACATTGAGGGCACTTGG + Intergenic
1119442298 14:74636660-74636682 GAGTTAACAGAGAGGGCACTGGG - Intergenic
1120697172 14:87657554-87657576 ACGTTAGCAAAGAGGGTTCTAGG + Intergenic
1121020955 14:90579884-90579906 CAGTTTCCAAAGTGGGCTCCAGG - Intronic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1122082804 14:99277955-99277977 GAGCTAGGAAAGAGAGCTCTGGG + Intergenic
1122143944 14:99677752-99677774 GGGTTGGCAAAGGGAGCTCTGGG + Exonic
1122498981 14:102182217-102182239 GATTTCCCAAAGAGGACTCTGGG + Intronic
1128115292 15:65101533-65101555 GAGTTGGCCAAGAGGGTTGTGGG - Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1130177314 15:81587115-81587137 GAGTTTTCAAAGAGGGTCTTTGG + Intergenic
1130847496 15:87761048-87761070 GAGTTTGCAGAGATGCTTCTGGG - Intergenic
1133344318 16:5059963-5059985 GAGTCTGAAAAGAGGCCTCTAGG + Intronic
1134263306 16:12671501-12671523 GAGGCTGTAAAGAGAGCTCTTGG + Intronic
1136037000 16:27548208-27548230 CAGTTGGCAAAGAGGACTGTTGG - Intronic
1138969272 16:62125116-62125138 GACTTTTCAAGGAGGGCTCACGG + Intergenic
1141165851 16:81660638-81660660 GTGTTTCTAAAGAGGGCACTGGG - Intronic
1142068662 16:88077199-88077221 GTGTTTGCAAAGCCAGCTCTCGG + Exonic
1148374411 17:47129432-47129454 AAATTTGCATAGAGGGTTCTTGG + Exonic
1152276771 17:79362590-79362612 AGCTTTGCAAAGAGGCCTCTGGG - Intronic
1154136816 18:11786927-11786949 GAGTGAGCTAAGAGGGCTATTGG + Intronic
1154493852 18:14941574-14941596 GTGTCTGGAAAGAGGGATCTGGG + Intergenic
1154979202 18:21488618-21488640 GTGCTGGCAAAGTGGGCTCTGGG - Intronic
1159916186 18:74189774-74189796 GAATTTGCAAAGGAGGCTCTTGG - Intergenic
1160689908 19:456710-456732 GAGTTTGCAGACAGAGTTCTAGG - Intronic
1161770859 19:6230053-6230075 GAGTTCCCCACGAGGGCTCTTGG - Intronic
1163000184 19:14362307-14362329 GATTTTGAAAATAGAGCTCTCGG + Intergenic
1164947606 19:32309707-32309729 GATTTTGCAGAGAAGGCCCTCGG - Intergenic
926440121 2:12879744-12879766 GAGGTTGCAAACAGGGGCCTGGG - Intergenic
926617022 2:15006726-15006748 GAGTTTGCAAAGCAGGTGCTTGG - Intergenic
928193216 2:29193397-29193419 CAGTCAGCGAAGAGGGCTCTAGG + Exonic
929075074 2:38074252-38074274 GAGTTTGCAAGCAGGGCCCCGGG - Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
932475364 2:72002603-72002625 GGAATTGCAAGGAGGGCTCTGGG + Intergenic
932950154 2:76283180-76283202 GAGTTTAATAAGAGGGCTATTGG - Intergenic
934691781 2:96366576-96366598 TAGTGTCCAAAGAGAGCTCTGGG + Intronic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
936595076 2:113840009-113840031 AAGGTTGTAACGAGGGCTCTGGG - Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
939597564 2:144145722-144145744 GAACTTGCAAAGAGGGTCCTAGG + Exonic
941892817 2:170599325-170599347 TATTTTCCAAAGAGAGCTCTGGG + Intronic
943807908 2:192146489-192146511 GAGCTTGCAAATTGGGCTTTAGG - Intronic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
944386197 2:199167689-199167711 CAGCTTGCAGAGAGGGTTCTGGG - Intergenic
945400721 2:209379250-209379272 AAGTGTCCAAAGAGGCCTCTGGG + Intergenic
946800519 2:223411134-223411156 GACTTTGTAGAGAGGGCTTTTGG + Intergenic
946993613 2:225364778-225364800 TATTTTGCAAAGAAGGCTCAAGG + Intergenic
947663401 2:231887108-231887130 GCGTTTGCGAAGGGCGCTCTGGG - Intergenic
947992355 2:234497323-234497345 GCGTTTGCAAAAATAGCTCTCGG + Intergenic
1170770363 20:19327474-19327496 GAGATTCCAGAGGGGGCTCTGGG - Intronic
1176306488 21:5126254-5126276 CAGTTTGCAAAGGGAGCTGTTGG - Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1179850571 21:44135776-44135798 CAGTTTGCAAAGGGAGCTGTTGG + Intronic
1182781962 22:32875279-32875301 CACTTTACAAAGAGGGCCCTCGG - Intronic
1184982717 22:48105619-48105641 GTGTTTGCAACGTGAGCTCTCGG + Intergenic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
951806442 3:26649477-26649499 GAGTATGAAAACAGGGATCTGGG - Intronic
955333063 3:58063361-58063383 GAGTTTGCAGAGAGCTCTGTTGG + Intronic
956065615 3:65394317-65394339 GAGTTTGCAAAACTGCCTCTCGG + Intronic
956196153 3:66655242-66655264 CTGTTTGCAAGGGGGGCTCTGGG + Intergenic
957054021 3:75430733-75430755 GGGTTTGCAAAGAAGGCCCAGGG + Intergenic
959446098 3:106441563-106441585 GTGTTTGCAAAGAAGACTTTGGG - Intergenic
960034253 3:113086791-113086813 GAGCTTGAAAAGAGGGCCTTTGG + Intergenic
960698386 3:120417357-120417379 GAGTTTGCAGAGCAGCCTCTGGG - Intronic
960965152 3:123099548-123099570 GAGTCTGCAGTGAGGGCTCGTGG + Intronic
961591309 3:127983804-127983826 GCATTTGCAAAGAGGTCACTGGG - Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
963498981 3:146101008-146101030 GAGTTAGAACAGAGGGCTTTTGG + Intronic
965422307 3:168476636-168476658 GAATTGACAAAGAGGGCACTGGG - Intergenic
965746962 3:171936021-171936043 GAGTTTGGAAAGAGGGTTACGGG + Intronic
966415743 3:179687766-179687788 GCATTTGGAAAGATGGCTCTGGG - Intronic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969243192 4:5915433-5915455 GAGCTTGGAAAGAGGGACCTTGG + Intronic
971085235 4:23267223-23267245 GAGTTTGCAAAGATGCTTCTGGG - Intergenic
971161794 4:24140921-24140943 GAGGATGCCAAGAGTGCTCTTGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
976311609 4:83618940-83618962 CAGTTTCCAAAGAGAGCTTTTGG - Intergenic
976407835 4:84679625-84679647 GAGATTGGAAAGATGGGTCTAGG - Intronic
980327959 4:131372700-131372722 TAGTTTGCAAATATGGATCTTGG - Intergenic
981893723 4:149771208-149771230 GGGGTTGCTAAGAGGGTTCTTGG - Intergenic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
986593111 5:9391840-9391862 GAGGTTGCAAAGAGATCTATTGG - Intronic
987390234 5:17368488-17368510 TAGTTTGGAAATAGGGCTTTGGG + Intergenic
987894903 5:23931767-23931789 GAGTTGGCAAAGAGCCTTCTTGG + Intergenic
988322706 5:29719770-29719792 ATGTTTGCAAGGAGGGCTCATGG + Intergenic
989328875 5:40232162-40232184 GATTTTACGAAGAGAGCTCTTGG + Intergenic
989816120 5:45739578-45739600 CAGTTTGCACAGAGCTCTCTTGG - Intergenic
992078730 5:73215171-73215193 TAGGTTGGAATGAGGGCTCTGGG - Intergenic
994066779 5:95552627-95552649 CACTTTCCAAAGAGGGCTTTCGG + Intronic
994734883 5:103540337-103540359 GTGTTTGGAAGGAGGGCACTTGG + Intergenic
996417614 5:123227303-123227325 GAGTTAACAAAGAGACCTCTAGG - Intergenic
996777634 5:127149929-127149951 GAGTGAGAAAAGAGAGCTCTAGG - Intergenic
1003293868 6:4806346-4806368 CATTTTGGAAAGATGGCTCTGGG - Intronic
1011674014 6:89713644-89713666 GAATTTGCAAATAGGCCTGTTGG - Intronic
1017399257 6:154040144-154040166 TACTGAGCAAAGAGGGCTCTTGG + Intronic
1020135815 7:5587291-5587313 GGATTTGCAAAGAGGGATGTGGG - Intergenic
1023162507 7:37310742-37310764 GAGATGGCATAGAGAGCTCTGGG + Intronic
1023966329 7:44964884-44964906 GGGCTGCCAAAGAGGGCTCTCGG - Intronic
1024128503 7:46325772-46325794 GAGGTTGCAGAGAGGACGCTGGG + Intergenic
1024568544 7:50705072-50705094 GCGTGAGCAAGGAGGGCTCTGGG - Intronic
1025164763 7:56703080-56703102 GAGTTTGCAACCAGGGGCCTCGG + Intergenic
1025585239 7:62776554-62776576 GAGTCTGCAAAGGGGTCTTTTGG + Intergenic
1026260750 7:68753386-68753408 GAGTTTGGGAAGCAGGCTCTGGG - Intergenic
1029085378 7:98007201-98007223 GAGTTTCCAAAGAGGGTTTGGGG + Intergenic
1029236220 7:99121691-99121713 GAGTTTGAAAAGAGACCTCTTGG - Intronic
1030442062 7:109598168-109598190 GAGTAGGCAAAGAGGAATCTGGG - Intergenic
1033041087 7:137918883-137918905 ATGTTTGTAAAGAGGGCTATAGG - Intronic
1034680076 7:152921993-152922015 TAGTTTGCACAGGGGGTTCTTGG + Intergenic
1034878802 7:154748477-154748499 GTGTTGGCAAACAGTGCTCTGGG - Intronic
1035775299 8:2182994-2183016 GAGTTTTCAAAGAGGCTCCTGGG - Intergenic
1036122533 8:6033808-6033830 GAGTTTTCAAAGTGAGTTCTGGG - Intergenic
1044605151 8:94041838-94041860 GAGTTTGCAGGGAGAGCTGTGGG - Intergenic
1045575234 8:103413435-103413457 AAGTTTGTAAAGATGGATCTGGG - Intronic
1045697499 8:104826441-104826463 GAATTTCCAAAGAGGGGTCCTGG + Intronic
1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG + Intronic
1048965249 8:139610092-139610114 GATTTTGAAATGAGGCCTCTGGG - Intronic
1049853112 8:144844894-144844916 GAGTGGGGAAAGAGGACTCTGGG + Intronic
1055384241 9:75743896-75743918 TGGTTTACAAACAGGGCTCTGGG - Intergenic
1057717514 9:97506208-97506230 GAGTTGGCACAGGGGGCTGTGGG - Intronic
1058121036 9:101139166-101139188 TAGTTTGCCATGAGGCCTCTTGG + Intronic
1060581168 9:124748053-124748075 GAGTTTGCAAATAGGAATTTAGG - Intronic
1186153385 X:6700526-6700548 GTGCTTGCAATGAGGGTTCTTGG - Intergenic
1187110212 X:16290665-16290687 GACTTTGCAAATATGGCACTAGG - Intergenic
1187283108 X:17877247-17877269 GAGTTTGAAAGCAGTGCTCTGGG - Intergenic
1187954263 X:24500517-24500539 CAGTTTGCAAAGCAGGCTCGTGG - Intronic
1190256048 X:48762937-48762959 GAGTCTGCAAAGCAGGATCTGGG + Intronic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1197929651 X:131681015-131681037 GAGTTTTCAATGAGTGGTCTTGG - Intergenic
1197945812 X:131839382-131839404 GAGTTTTCAATGAGTGGTCTTGG + Intergenic
1201643849 Y:16205783-16205805 GAGTTGGCAAAGAGAGTTATGGG + Intergenic
1201658966 Y:16379538-16379560 GAGTTGGCAAAGAGAGTTATGGG - Intergenic