ID: 1129116758

View in Genome Browser
Species Human (GRCh38)
Location 15:73368924-73368946
Sequence CGCAGCTCGCGGGTTGCCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129116747_1129116758 23 Left 1129116747 15:73368878-73368900 CCGGCAGCGCTCGGGCTCCCGCG 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116745_1129116758 27 Left 1129116745 15:73368874-73368896 CCCTCCGGCAGCGCTCGGGCTCC 0: 1
1: 0
2: 1
3: 11
4: 118
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116746_1129116758 26 Left 1129116746 15:73368875-73368897 CCTCCGGCAGCGCTCGGGCTCCC 0: 1
1: 0
2: 0
3: 20
4: 168
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116751_1129116758 0 Left 1129116751 15:73368901-73368923 CCCCGGAATATTCATGAAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116753_1129116758 -2 Left 1129116753 15:73368903-73368925 CCGGAATATTCATGAAGCCGCCG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116752_1129116758 -1 Left 1129116752 15:73368902-73368924 CCCGGAATATTCATGAAGCCGCC 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116750_1129116758 5 Left 1129116750 15:73368896-73368918 CCGCGCCCCGGAATATTCATGAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28
1129116749_1129116758 6 Left 1129116749 15:73368895-73368917 CCCGCGCCCCGGAATATTCATGA 0: 1
1: 0
2: 1
3: 3
4: 23
Right 1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129116758 Original CRISPR CGCAGCTCGCGGGTTGCCAT AGG Exonic
923018448 1:230145048-230145070 CGCAGCTCTGGAGTGGCCATCGG - Intronic
1073390824 10:103175402-103175424 CACAGCTAGCGGGTTGGAATGGG + Intronic
1085666269 11:78417799-78417821 CGCAGCTCGCGGGAGGCCAGGGG + Exonic
1109622355 13:64926034-64926056 TGCAGCTAGCGGGATGCCAGCGG + Intergenic
1122053308 14:99074846-99074868 CCCAGCTCGGGGCTTGCCCTTGG + Intergenic
1129116758 15:73368924-73368946 CGCAGCTCGCGGGTTGCCATAGG + Exonic
1136037135 16:27549242-27549264 CGCAGATCTCGAGTTGCCCTAGG + Intronic
1145200317 17:20938774-20938796 CACAGCTCCCCGGTGGCCATGGG - Intergenic
1151430550 17:74059670-74059692 AGCAGCTGGTGGGTTGCCATGGG + Intergenic
1151856661 17:76726690-76726712 CGCCTCTCGCGGTTTTCCATTGG + Intronic
1161306817 19:3573226-3573248 CCCAGTTCGCGGTCTGCCATCGG + Intronic
1167609873 19:50501878-50501900 CGCAGCTCCCAGGCTGCCCTTGG + Intergenic
926630228 2:15129076-15129098 CGCAGCTCTCCGGCTGCCACGGG + Intergenic
929242495 2:39666420-39666442 CGCAGCCCGCGGCTTCCCAGGGG + Intronic
929862430 2:45691142-45691164 CACAGCTCGCTGGTTTCCAAAGG - Intronic
944522542 2:200586573-200586595 CTCAGCTCGCGGGGTGCGTTTGG + Intronic
1175775231 20:61648932-61648954 CCCACCTCGCAGGTGGCCATCGG + Intronic
1175775608 20:61651621-61651643 CCCACCTCGCAGGTGGCCATCGG + Intronic
1176143226 20:63554132-63554154 CGCACTCCGCGGGTTGCCCTGGG - Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1183586628 22:38756381-38756403 GGCAGCGCGCGGGTGGCCCTTGG + Intronic
1183743399 22:39680295-39680317 CCCAGCTCAGGGGTTCCCATGGG + Intronic
1184391199 22:44204638-44204660 GGCCCCTGGCGGGTTGCCATGGG + Intronic
953925336 3:46979787-46979809 CGCCGCCCGCCGGTTGCCCTCGG - Exonic
969260735 4:6031632-6031654 CACAGCTTTGGGGTTGCCATGGG + Intronic
1001823002 5:174724601-174724623 CGCCGCTGCCGGGTTGCCAGCGG + Exonic
1007515372 6:42406514-42406536 CTCAGCTCACAGGTTGCAATCGG + Intronic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1019377318 7:699730-699752 CGGAGCCCGTGGGTGGCCATGGG + Intronic
1035422526 7:158741547-158741569 CGCAGCTCCTGGGTGGCGATGGG + Exonic
1040915497 8:52564099-52564121 CGCAGCTAGCGGCTGGCCGTGGG - Intronic