ID: 1129116865

View in Genome Browser
Species Human (GRCh38)
Location 15:73369334-73369356
Sequence TTCCCGCAACCCTCCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129116854_1129116865 30 Left 1129116854 15:73369281-73369303 CCGACTTTCCTCTTGGGAGGCGA 0: 1
1: 0
2: 1
3: 8
4: 114
Right 1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 103
1129116859_1129116865 7 Left 1129116859 15:73369304-73369326 CCGGGTTCGTCTGGATGCAGAGT 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 103
1129116857_1129116865 22 Left 1129116857 15:73369289-73369311 CCTCTTGGGAGGCGACCGGGTTC 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129116865 Original CRISPR TTCCCGCAACCCTCCTGGAG AGG Intergenic
900697079 1:4019179-4019201 TTCCAGAAACCCTCCCAGAGAGG - Intergenic
902412350 1:16218843-16218865 TCCCCTCAACTCTCATGGAGAGG + Intergenic
903736910 1:25535610-25535632 CTCCCGCACCCCTCCGGGTGTGG - Intergenic
904925943 1:34048340-34048362 TTCCATCAAACCTCCTGGGGTGG - Intronic
905150543 1:35923530-35923552 TTCCAGCTACCATCCTGGATTGG - Exonic
907046673 1:51303805-51303827 GTCCCGCAACCCTCCTGGCCAGG + Intronic
908907937 1:69037946-69037968 TTCCCTCACCTCTCCTGAAGAGG - Intergenic
916179423 1:162070565-162070587 TTCCCGGATCCCTCCTCCAGAGG + Intronic
917980327 1:180265333-180265355 CTCCCGCCTCCCTCCTGAAGCGG + Intronic
922175081 1:223190399-223190421 TGCCCGCCACCCACCTGGATTGG + Intergenic
924427206 1:243962764-243962786 ATCCCACAGCCCTCCTGGTGGGG - Intergenic
1064195257 10:13238988-13239010 TTCCCAAAACCCTCCTGGAATGG - Intergenic
1066185401 10:33005707-33005729 TTCCCGCATCCCTCCGGGCTTGG + Intronic
1067564389 10:47326227-47326249 TTCCCACAACCCAGTTGGAGGGG + Exonic
1068157991 10:53225190-53225212 CTCCCTCAACCCTCCTAGATGGG - Intergenic
1069550380 10:69360137-69360159 TTCCAGCAACCCTCTTCCAGGGG - Intronic
1071282846 10:84118477-84118499 TTCCCACAACCCTCCTTCCGTGG + Intergenic
1071393014 10:85194509-85194531 TTCCCGCAACACTCATTGATGGG - Intergenic
1074107973 10:110402585-110402607 TTCCCTGAACCCTCCTGGTCAGG + Intergenic
1076363367 10:129905704-129905726 TCCCCGCCACCGTCCTGGAGAGG - Intronic
1078442227 11:11377547-11377569 TTCCGGCAATCCTCAGGGAGCGG - Intronic
1079368622 11:19831206-19831228 CCCCCGCAACACTCCTGGAATGG - Intronic
1079845627 11:25462898-25462920 GTCCCCCAACCATCCTGCAGAGG + Intergenic
1084572467 11:69967925-69967947 TTTCAGCAACACTCATGGAGTGG + Intergenic
1093453357 12:19340348-19340370 TCCCCGCCTCCCTCCTGGACGGG - Intronic
1095401028 12:41814636-41814658 TTGGAGCAACCCCCCTGGAGTGG - Intergenic
1096346486 12:50851643-50851665 TTTCTGCAACCTTGCTGGAGAGG + Intronic
1096484690 12:51971003-51971025 CTCCCACACCCCTCCTGGTGAGG + Intronic
1097261060 12:57720545-57720567 GGCCCCCAGCCCTCCTGGAGTGG + Intronic
1101939324 12:109088352-109088374 CCACCGCCACCCTCCTGGAGGGG + Exonic
1104797968 12:131532904-131532926 TTGCAGGAAGCCTCCTGGAGTGG - Intergenic
1106474916 13:30090245-30090267 CTCCCATAACCCTCCTGGAAGGG + Intergenic
1107499139 13:40955882-40955904 TCCCCGCCTCCCTCCTGGATGGG - Intronic
1109974185 13:69809158-69809180 TTTCCGCAATCTTCCTGAAGAGG + Intronic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1115628610 14:35220587-35220609 TGCTCCCAACCCTCCTGGAGGGG - Intronic
1121341034 14:93105252-93105274 CTCCAGCAAACCTCCTGGAGGGG + Intronic
1122272025 14:100572569-100572591 TGCCCTTACCCCTCCTGGAGGGG + Intronic
1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG + Intergenic
1129677830 15:77642016-77642038 TTCCCACAACCCTCCAAGATAGG - Intronic
1129772204 15:78209410-78209432 TTTCCACAACCTCCCTGGAGTGG - Intronic
1130894822 15:88161755-88161777 TGCCCAAATCCCTCCTGGAGAGG - Intronic
1132684491 16:1156626-1156648 GCCCCGCATCCCTCCTGAAGAGG + Intronic
1133843811 16:9435955-9435977 CTCCCTCAACTCTCCTGGAAAGG - Intergenic
1143009394 17:3857599-3857621 CACCAGCACCCCTCCTGGAGAGG + Intergenic
1143931477 17:10432806-10432828 TTCCAGCAACCCTCCCGCATTGG + Intergenic
1147332755 17:39708490-39708512 CTCCCGCAGGCCTCCTGGGGAGG - Exonic
1148690390 17:49523853-49523875 TTCTGGCAACCTCCCTGGAGAGG - Intergenic
1151957166 17:77386228-77386250 TGCCCCCACCCCTCCTGCAGAGG + Intronic
1152467161 17:80472964-80472986 TTCCCGGATGCCTCCTGGGGTGG - Intronic
1152735168 17:81993719-81993741 TTGCAGCAACCCTCCGGGATGGG - Intronic
1154217790 18:12428262-12428284 TTCCATCAACTCTGCTGGAGGGG - Intronic
1155633999 18:27929256-27929278 TTCCTCAAAGCCTCCTGGAGAGG - Intergenic
1158936450 18:62369261-62369283 CTGCCGGAACCCTCCTGGGGAGG + Exonic
1160659177 19:290604-290626 TTCCCGGGACCCTGCGGGAGGGG + Intronic
1162440834 19:10691141-10691163 TGCCTGCAACACTCATGGAGAGG + Exonic
1163414320 19:17176732-17176754 TTCCCCCATCCTGCCTGGAGTGG + Intronic
1164669710 19:30065473-30065495 TTGCCCCAACCTTCCTGGAGAGG - Intergenic
1164912545 19:32024805-32024827 TGCCCCCAAACCTACTGGAGAGG + Intergenic
1165156505 19:33792121-33792143 CTCCCCCGACCCCCCTGGAGAGG + Intergenic
1166531428 19:43545787-43545809 TCCCCCCATCCCTCCTGAAGTGG - Intronic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
933799504 2:85949427-85949449 TTCCCACAATCCTACTGGGGAGG + Intergenic
937967049 2:127520654-127520676 TTACCATAACCTTCCTGGAGAGG + Intronic
942661537 2:178270116-178270138 TACCCCCAACCCTGCTGCAGGGG - Intronic
947543767 2:230996164-230996186 CTCCCGGCTCCCTCCTGGAGGGG - Exonic
947739483 2:232478604-232478626 TTCCTGCCACCCTCCTGGGTGGG - Intergenic
948244849 2:236472117-236472139 TTCCCCAAAGCCTCCTAGAGTGG + Intronic
1170889323 20:20365223-20365245 TTCGCGAAGCCCCCCTGGAGGGG + Intergenic
1173664269 20:44753796-44753818 ATCCCGCTCACCTCCTGGAGGGG - Intronic
1179047639 21:37860701-37860723 CTCCCACTACCCCCCTGGAGTGG + Intronic
1182286957 22:29254339-29254361 TTCCCCAAGCCCTCCTGGGGTGG + Intronic
1184692317 22:46122913-46122935 CTCCTGCAACCCCACTGGAGGGG - Intergenic
950636606 3:14319891-14319913 TTCCCGCTTGCCTCCTGCAGAGG + Intergenic
951582351 3:24179198-24179220 TTCCTGCCACCCCCTTGGAGGGG - Intronic
953451233 3:43008207-43008229 TTCCTGCAACCTCCCTGGAAGGG - Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
966772610 3:183517503-183517525 TTCCTGGAAGCCTCATGGAGTGG + Intronic
967177668 3:186874421-186874443 TCCCCGCCTCCCTCCTGGATGGG - Intergenic
973531640 4:51842511-51842533 TTCCAGCAAACCTTCTGGTGGGG - Intergenic
981315754 4:143337726-143337748 TTCCCGCAACCCATCTCGAGGGG - Intronic
984682512 4:182625788-182625810 TTCCCTCAACGCCACTGGAGAGG - Intronic
985911405 5:2886781-2886803 TTCCCCCAACCCCCCTGCAATGG - Intergenic
986165752 5:5270252-5270274 TTCCCACAACTCTCCTGCACTGG + Intronic
989821052 5:45796288-45796310 ATCCCACTACCCTCCTGGAAAGG + Intergenic
991065960 5:62425228-62425250 TTCCTCCAACCCTCCTTGGGGGG + Intronic
997709040 5:135987668-135987690 TTCCCGCAAACTCCCTGGAGTGG + Intergenic
998106727 5:139473554-139473576 TTCCCCCATCCCTTCTGGAGAGG - Intergenic
998156256 5:139788626-139788648 TTCCCGGGACTCTCCTGGACAGG + Intergenic
998757361 5:145395455-145395477 TTCCGGCTACCCTTCTGAAGAGG - Intergenic
1001479586 5:172078804-172078826 TTCCTGGAACCCTGCTGGTGAGG + Intronic
1009694743 6:67087867-67087889 TTTCCTCAACCTTCCTAGAGAGG - Intergenic
1019075343 6:169382856-169382878 TTCCCGGAGCCTTCCTGGGGAGG - Intergenic
1023694307 7:42829066-42829088 TTCCTACAACACTCCTGAAGAGG - Intergenic
1024209599 7:47192147-47192169 CTCCCGCCACCCTTCTGGGGAGG - Intergenic
1025821346 7:64967619-64967641 TCCCCGCCTCCCTCCTGGATGGG + Intergenic
1027139995 7:75650154-75650176 CTCCCGCAGCCTGCCTGGAGAGG - Intronic
1030735500 7:113043185-113043207 TTCCTCCAACCCTTCTGCAGTGG - Intergenic
1031604219 7:123749020-123749042 CTCCCCCAACCCTCCCGCAGCGG + Exonic
1031987686 7:128173772-128173794 ATCCAGCAACCCTACAGGAGGGG - Intergenic
1040043362 8:42939353-42939375 TTCCCACCTCCCTCCTGGACGGG + Intronic
1040785609 8:51159494-51159516 TCCCCGCCTCCCTCCTGGATGGG - Intergenic
1049786478 8:144453248-144453270 TTCCCCGCTCCCTCCTGGAGAGG - Exonic
1051594539 9:18811230-18811252 GCCCCCCAACCCTCATGGAGGGG + Intronic
1051726404 9:20091304-20091326 TTTCCCCAACCCCACTGGAGAGG + Intergenic
1056570509 9:87810595-87810617 TTCATGCGTCCCTCCTGGAGTGG - Intergenic
1061370312 9:130194039-130194061 TTCCGCCATCCCTCCTGGGGCGG - Intronic
1061747716 9:132752657-132752679 TTCCCCCAGCTCTCCTGGAATGG + Intronic
1186564290 X:10645837-10645859 ATCCCTCAACTCTCCTGGATTGG + Intronic
1188003175 X:25001038-25001060 TTCCCTCAACCCTCCCACAGAGG + Intergenic
1190874299 X:54448954-54448976 TTCCCACAAACCACCTGGGGTGG + Exonic
1195548573 X:106140225-106140247 TTCCCCCAACCTACCTAGAGAGG + Intergenic
1198714059 X:139537618-139537640 TTCCTTCCACCCTCCTGGGGTGG - Intronic
1200364378 X:155645683-155645705 TTCCCCCAACCCTCTGGCAGTGG - Intronic