ID: 1129117296

View in Genome Browser
Species Human (GRCh38)
Location 15:73371668-73371690
Sequence GGGCAGGCACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129117286_1129117296 4 Left 1129117286 15:73371641-73371663 CCCATCTGCTCATGCAGGTGGGG No data
Right 1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG No data
1129117282_1129117296 29 Left 1129117282 15:73371616-73371638 CCACAGGGCAGGCTGTGCTCTAC No data
Right 1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG No data
1129117288_1129117296 3 Left 1129117288 15:73371642-73371664 CCATCTGCTCATGCAGGTGGGGT No data
Right 1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129117296 Original CRISPR GGGCAGGCACAGATGGAGGA AGG Intergenic
No off target data available for this crispr