ID: 1129123095

View in Genome Browser
Species Human (GRCh38)
Location 15:73414999-73415021
Sequence CAGGAGCCTCCACTGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129123095_1129123102 6 Left 1129123095 15:73414999-73415021 CCTCATCACAGTGGAGGCTCCTG No data
Right 1129123102 15:73415028-73415050 AGGCCTATGCCTCCCCTATGGGG No data
1129123095_1129123101 5 Left 1129123095 15:73414999-73415021 CCTCATCACAGTGGAGGCTCCTG No data
Right 1129123101 15:73415027-73415049 CAGGCCTATGCCTCCCCTATGGG No data
1129123095_1129123100 4 Left 1129123095 15:73414999-73415021 CCTCATCACAGTGGAGGCTCCTG No data
Right 1129123100 15:73415026-73415048 GCAGGCCTATGCCTCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129123095 Original CRISPR CAGGAGCCTCCACTGTGATG AGG (reversed) Intergenic
No off target data available for this crispr