ID: 1129124224

View in Genome Browser
Species Human (GRCh38)
Location 15:73424036-73424058
Sequence CTGCATTATGTAACATCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129124224_1129124227 3 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124227 15:73424062-73424084 TTAAAATGATGCTTAGAACCGGG No data
1129124224_1129124228 10 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124228 15:73424069-73424091 GATGCTTAGAACCGGGAGCTTGG No data
1129124224_1129124230 12 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124230 15:73424071-73424093 TGCTTAGAACCGGGAGCTTGGGG No data
1129124224_1129124231 13 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124231 15:73424072-73424094 GCTTAGAACCGGGAGCTTGGGGG No data
1129124224_1129124229 11 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124229 15:73424070-73424092 ATGCTTAGAACCGGGAGCTTGGG No data
1129124224_1129124226 2 Left 1129124224 15:73424036-73424058 CCAAATGATGTTACATAATGCAG No data
Right 1129124226 15:73424061-73424083 ATTAAAATGATGCTTAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129124224 Original CRISPR CTGCATTATGTAACATCATT TGG (reversed) Intergenic