ID: 1129124225

View in Genome Browser
Species Human (GRCh38)
Location 15:73424059-73424081
Sequence GGTTCTAAGCATCATTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129124225_1129124231 -10 Left 1129124225 15:73424059-73424081 CCATTAAAATGATGCTTAGAACC No data
Right 1129124231 15:73424072-73424094 GCTTAGAACCGGGAGCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129124225 Original CRISPR GGTTCTAAGCATCATTTTAA TGG (reversed) Intergenic