ID: 1129124227 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:73424062-73424084 |
Sequence | TTAAAATGATGCTTAGAACC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129124224_1129124227 | 3 | Left | 1129124224 | 15:73424036-73424058 | CCAAATGATGTTACATAATGCAG | 0: 1 1: 0 2: 0 3: 19 4: 158 |
||
Right | 1129124227 | 15:73424062-73424084 | TTAAAATGATGCTTAGAACCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129124227 | Original CRISPR | TTAAAATGATGCTTAGAACC GGG | Intergenic | ||