ID: 1129124229 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:73424070-73424092 |
| Sequence | ATGCTTAGAACCGGGAGCTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129124224_1129124229 | 11 | Left | 1129124224 | 15:73424036-73424058 | CCAAATGATGTTACATAATGCAG | 0: 1 1: 0 2: 0 3: 19 4: 158 |
||
| Right | 1129124229 | 15:73424070-73424092 | ATGCTTAGAACCGGGAGCTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129124229 | Original CRISPR | ATGCTTAGAACCGGGAGCTT GGG | Intergenic | ||