ID: 1129124678

View in Genome Browser
Species Human (GRCh38)
Location 15:73428663-73428685
Sequence TCCCAAAGTTGAGGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129124670_1129124678 3 Left 1129124670 15:73428637-73428659 CCTCAAGTGATCCACCCGCCTCA 0: 1934
1: 15212
2: 48460
3: 86845
4: 104293
Right 1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG No data
1129124671_1129124678 -8 Left 1129124671 15:73428648-73428670 CCACCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG No data
1129124669_1129124678 8 Left 1129124669 15:73428632-73428654 CCTGACCTCAAGTGATCCACCCG 0: 4653
1: 35878
2: 90596
3: 118759
4: 133049
Right 1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG No data
1129124668_1129124678 26 Left 1129124668 15:73428614-73428636 CCAGGCTGGTCTCGAACTCCTGA 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
Right 1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129124678 Original CRISPR TCCCAAAGTTGAGGGATTAC AGG Intergenic
No off target data available for this crispr