ID: 1129127722

View in Genome Browser
Species Human (GRCh38)
Location 15:73458885-73458907
Sequence GGTTCTATTACCCCATAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129127719_1129127722 11 Left 1129127719 15:73458851-73458873 CCACAAGTTCATATGTCTAGCTA 0: 1
1: 0
2: 2
3: 5
4: 111
Right 1129127722 15:73458885-73458907 GGTTCTATTACCCCATAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129127722 Original CRISPR GGTTCTATTACCCCATAAGA AGG Intronic
903544096 1:24112780-24112802 GGTGCGTTTACCCTATAAGAAGG - Intergenic
910983795 1:92984535-92984557 GGTGCTATTACACCAGAAGAAGG + Intergenic
912457272 1:109806475-109806497 GCTTCTATTCCCACATTAGAAGG - Intergenic
912627429 1:111217248-111217270 GGTTCTATTAGCAGAGAAGAAGG - Intronic
915448807 1:155990451-155990473 GGTTCTATTACACCATTATGTGG + Intronic
919341101 1:196307997-196308019 GTTTCTATTTCCCCAGATGATGG - Intronic
922842900 1:228658720-228658742 GGTTCCAGGACCCCATAAGTAGG + Intergenic
1067929160 10:50542134-50542156 GTTTCTTTTCCCCCATGAGAAGG - Intronic
1070489017 10:76958417-76958439 GTTTCTATTACCCTAAAATAGGG - Intronic
1074007338 10:109440666-109440688 TATTCTGTTACCCCAAAAGAAGG - Intergenic
1096184939 12:49572696-49572718 TGTTCTAATCCCCCAGAAGATGG - Intronic
1096949288 12:55448519-55448541 GATTCTATTACCCCTCAGGAGGG - Intergenic
1099166495 12:79313537-79313559 CATTCTATTAACCAATAAGAGGG + Intronic
1099908652 12:88802582-88802604 AGTTCTATTACCACCTGAGAAGG + Intergenic
1117786560 14:59291923-59291945 GGTTCTATTACCTCAAGAGATGG + Intronic
1122400123 14:101462043-101462065 AGTTCTAGGACCCCATGAGATGG + Intergenic
1127343541 15:58070142-58070164 GATTCAATTAGCCCAGAAGAGGG - Intronic
1129127722 15:73458885-73458907 GGTTCTATTACCCCATAAGAAGG + Intronic
1135934480 16:26768109-26768131 GGTGCTGTTCCCCCATAGGAAGG - Intergenic
1136244603 16:28967200-28967222 GGTTCTAGTACCACAGAAGGAGG - Intergenic
1142832081 17:2556730-2556752 GGTTCTATTACTCATAAAGAGGG - Intergenic
1143974115 17:10817564-10817586 GGTTTTATTACCAAAGAAGATGG + Intergenic
1149550381 17:57535210-57535232 GGTTCCCTTCCCCCATAAGGAGG - Intronic
1154148337 18:11885164-11885186 GGTTCTTTTACTTCATAAAAAGG - Exonic
1160099528 18:75907029-75907051 GGTTCTCTCACTCCATCAGATGG + Intergenic
1162556730 19:11391350-11391372 GGTTCCATTACCATAGAAGAAGG + Intronic
929440099 2:41958921-41958943 GATACTATTACCTCATAAGTAGG - Intergenic
930356948 2:50333222-50333244 GGGACTATAACCCCATAAGCTGG - Intronic
930625731 2:53695767-53695789 TGTTCTATTATCCCATTAAATGG + Intronic
930867062 2:56132356-56132378 TGTTCTATTTCCCCAGTAGATGG - Intergenic
935693492 2:105750601-105750623 GGTTGTAGCACCCCATAACAGGG + Intronic
944871730 2:203918921-203918943 GGTGCTATTACCAGAAAAGAAGG - Intergenic
946355001 2:219178823-219178845 GGTGCCATTACCCCATCAGTAGG + Intronic
1169237330 20:3941540-3941562 TGTTCTAATAACCCAAAAGAAGG + Intronic
1169796677 20:9469971-9469993 GGTATTATTCCCCCAAAAGAAGG - Intronic
1170902589 20:20480410-20480432 GGATATATTACCCCATGAGTTGG + Intronic
1173075449 20:39814218-39814240 GGTTCTCTTACCCCATCAAAGGG + Intergenic
1181018066 22:20082673-20082695 GGTTCTTTTAAACCATAAGATGG + Intronic
1185177996 22:49341188-49341210 TGTACTATGACCACATAAGACGG + Intergenic
952230979 3:31430652-31430674 GGTTGAATTACCCCACAAGTAGG + Intergenic
956973089 3:74549765-74549787 GGTTGTATGACCCCATGAGAAGG - Intergenic
959886258 3:111504745-111504767 GGTTAAATTACCCCATATTATGG + Intronic
963948761 3:151175491-151175513 GGTTATATAACACCATAAAAAGG - Intronic
970822663 4:20237058-20237080 GTCTCTATTTTCCCATAAGAGGG + Intergenic
972314980 4:37917681-37917703 GCTTCTCTTTCCCCATGAGAAGG + Intronic
973093832 4:46172257-46172279 GGTTATATTAAGCTATAAGAGGG - Intergenic
976427195 4:84918967-84918989 AATACTATTACCCAATAAGAAGG + Intronic
981162363 4:141513837-141513859 TCTTCTATGATCCCATAAGAAGG - Intergenic
981594789 4:146407700-146407722 GGTTCTGTTAACATATAAGAGGG - Intronic
981652485 4:147075690-147075712 GCTTCTCTTACCCCATATTATGG + Intergenic
989324513 5:40175618-40175640 TGTTCTATTACCTCATAAAAGGG + Intergenic
990218010 5:53555474-53555496 GGTTCTATTACCACAAAAAAGGG + Intergenic
992623185 5:78613510-78613532 AGGTCTAATACCCCATAAGGTGG + Intronic
998591396 5:143482482-143482504 GGTTCTCTTACTCGATAAGTGGG + Intergenic
1001724153 5:173882627-173882649 GGTTCTATTACTAAAGAAGAAGG - Intergenic
1018423456 6:163660255-163660277 GGTTCTATTACTGTAGAAGAAGG + Intergenic
1020938000 7:14492188-14492210 GCTTTTATTACCCCAAAACAGGG + Intronic
1021885838 7:25137856-25137878 GGTTAAATTACCCCATATTATGG - Intronic
1022122342 7:27321679-27321701 GGTTCTGTTACCAGAAAAGAGGG - Intergenic
1023492470 7:40758746-40758768 TGTTCTAATACCACATAGGAAGG + Intronic
1024654965 7:51444411-51444433 AGTACTATTGCCCCATATGATGG + Intergenic
1026246158 7:68621573-68621595 GGTCCTATTATCCCAATAGAAGG - Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1033057353 7:138070594-138070616 GGTTCTAGTTCCAAATAAGATGG + Intronic
1043691096 8:83152979-83153001 GGTCTTATTACCTAATAAGATGG - Intergenic
1045485635 8:102628765-102628787 GGTATTATTACCCCATCTGATGG + Intergenic
1045648650 8:104323328-104323350 GGTGCTATTATCACACAAGAAGG + Intergenic
1047371063 8:124256506-124256528 TGGTCTATTACCCCATGAGAAGG + Intergenic
1050041988 9:1505556-1505578 GGTTCTATGATACCATAAAATGG - Intergenic
1055324700 9:75117262-75117284 TGTTCTATACCACCATAAGATGG - Intronic
1186551192 X:10507384-10507406 GGTTCTATTAAACAATAAGAAGG - Intronic
1188293059 X:28412471-28412493 GGTACTGTTACCTCATAAAAAGG - Intergenic
1195698550 X:107684712-107684734 GGTCCTATTCTCCCATAAGAGGG + Intergenic
1196512765 X:116531772-116531794 GGTTCTGTTACCATATAACACGG + Intergenic
1199320201 X:146428905-146428927 GGTTCTTTTACTTCAAAAGAAGG + Intergenic
1200277053 X:154743771-154743793 GGCTCTATTAGCCCAAGAGAAGG + Intronic