ID: 1129128872

View in Genome Browser
Species Human (GRCh38)
Location 15:73472322-73472344
Sequence GGGAGAATTACAACCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129128871_1129128872 -6 Left 1129128871 15:73472305-73472327 CCAAATACTGGGAAAGAGGGAGA 0: 1
1: 0
2: 2
3: 29
4: 360
Right 1129128872 15:73472322-73472344 GGGAGAATTACAACCACTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 114
1129128868_1129128872 1 Left 1129128868 15:73472298-73472320 CCAAGTTCCAAATACTGGGAAAG 0: 1
1: 0
2: 1
3: 20
4: 198
Right 1129128872 15:73472322-73472344 GGGAGAATTACAACCACTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 114
1129128865_1129128872 8 Left 1129128865 15:73472291-73472313 CCACTGACCAAGTTCCAAATACT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1129128872 15:73472322-73472344 GGGAGAATTACAACCACTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129128872 Original CRISPR GGGAGAATTACAACCACTGA AGG Intronic
901383332 1:8889741-8889763 TGGAGAATTCCAACATCTGAAGG + Intergenic
909740196 1:79019168-79019190 GGAAGAATTACAACCTCCCAAGG - Intergenic
910114714 1:83719136-83719158 GGCACATTTACAACCACTGTTGG + Intergenic
910736643 1:90465558-90465580 GGAAGAATGAAAACCATTGAAGG - Intergenic
911067116 1:93800059-93800081 GGGAGTATTACAAGGACTGGTGG + Intronic
911243994 1:95496673-95496695 GGGAGAATTAAGTGCACTGAAGG - Intergenic
911987560 1:104648410-104648432 GGCAGAATTTCAACAAGTGAAGG + Intergenic
915590134 1:156866153-156866175 GGGAGAAGTACCACCACATAGGG - Intronic
919407761 1:197205947-197205969 GGAAGAATTAGAAACTCTGAAGG - Intergenic
921382902 1:214543270-214543292 GGGAGAATAAATATCACTGAAGG - Intronic
1064459670 10:15521793-15521815 GGTAGAATTGCAACCACGGTGGG - Intronic
1064714878 10:18166662-18166684 AGGAGAGTAAAAACCACTGAGGG + Intronic
1065046609 10:21752017-21752039 GAGAGAATTTAAACCACTAAAGG + Intergenic
1065867772 10:29928565-29928587 GGGAGAATAACAAACACTGACGG - Intergenic
1066344252 10:34567561-34567583 GTCAGATTTACAACCACTCACGG + Intronic
1067291719 10:44948416-44948438 GGGAGCATCAGAACCACAGAAGG + Intergenic
1076224626 10:128764366-128764388 GGGAGCATTGCAAACACTCACGG - Intergenic
1076253926 10:129005064-129005086 GGGAGAAATACAGCCTCTGCTGG - Intergenic
1079079804 11:17406313-17406335 GGGCAAATTACACCCACTTAGGG + Intronic
1081402679 11:42661459-42661481 GGGAGAATCCTATCCACTGAAGG - Intergenic
1081576888 11:44324297-44324319 GGGAGAATTTGAACCCTTGATGG - Intergenic
1083557435 11:63642021-63642043 GGGAAAAGTACAACCAATAATGG + Intronic
1084865028 11:72048753-72048775 GAGAGCTTTACAAACACTGAAGG + Intronic
1087906623 11:103704834-103704856 TGGAAAATGAAAACCACTGAAGG - Intergenic
1091760062 12:3081265-3081287 GTGAGGATGACAACCACTGCAGG - Intronic
1095486891 12:42694780-42694802 GGGAGAATAACAACCACACAGGG + Intergenic
1096522135 12:52190359-52190381 GGGAAAATAACAGCCACTGCAGG + Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098780835 12:74684660-74684682 GCCAGAATTAGAAACACTGAGGG + Intergenic
1103547568 12:121712943-121712965 GGGAGAATTTCAAGAACTGCAGG + Exonic
1103826459 12:123742943-123742965 AGAAGAATTGCAAACACTGATGG + Intronic
1105293698 13:19070924-19070946 GGCAGAATAACAGCCCCTGAAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109872493 13:68352209-68352231 GAGAGAATGAGAATCACTGAGGG - Intergenic
1114471242 14:22964140-22964162 GGGAGAAATAGAACAACTAAAGG + Intronic
1114490464 14:23097859-23097881 AGAAAAATTACAACCACTGCTGG + Exonic
1125219019 15:37311623-37311645 GGGAAAATTAATACCACTGGAGG + Intergenic
1127401798 15:58594395-58594417 GGGACAAATACAAGGACTGAGGG + Exonic
1128380756 15:67110299-67110321 GGGAGAATCACCACCTCTGCTGG + Intronic
1129128872 15:73472322-73472344 GGGAGAATTACAACCACTGAAGG + Intronic
1130408805 15:83626999-83627021 GGGAGAATTAGAGCCACAGAGGG - Intergenic
1137691482 16:50430986-50431008 TGGAGAATTCCATCCCCTGAGGG - Intergenic
1139430231 16:66907202-66907224 GGGAGAAAAACAACCTCTGTGGG - Intergenic
1140590044 16:76340882-76340904 GGGAAAATTAGCACCACTGGAGG - Intronic
1141320039 16:82999885-82999907 GGGACAATTTCACCCCCTGAGGG + Intronic
1144628182 17:16856224-16856246 GGGAGCATTTCCATCACTGAAGG + Intergenic
1145159773 17:20566791-20566813 GGGAGCATTTCCATCACTGAAGG + Intergenic
1146603249 17:34236320-34236342 GGGAGAATGGCACACACTGATGG - Intergenic
1146619258 17:34384576-34384598 GGGAGAAATAATACCACTCAGGG - Intergenic
1152163462 17:78684301-78684323 AGAAGAATGAGAACCACTGATGG + Intronic
1152184225 17:78844124-78844146 TGGGGAATTCCAACCACCGATGG - Intergenic
1155536836 18:26827475-26827497 GGAAGGATTACAATGACTGATGG - Intergenic
1157209535 18:45730093-45730115 GGTAGCATTACAGACACTGATGG + Intronic
1158965151 18:62616207-62616229 GGGAGAATTAAAAACCCTGCTGG - Intergenic
1158971323 18:62669449-62669471 GGGTGTATTACTACCACTGTTGG - Intergenic
1161725903 19:5928652-5928674 GAGAGAATTCAAACTACTGACGG + Intronic
1164834103 19:31346229-31346251 GGTAGAATAACAACCACAAAAGG - Intronic
1168124574 19:54276370-54276392 GGCAGAATTACCTCCACTGCAGG + Exonic
1168177413 19:54635168-54635190 GGCAGAATTACCTCCACTGCAGG - Exonic
926723886 2:15982775-15982797 GGGGGAATTAAAACCACGAAAGG - Intergenic
927351834 2:22125182-22125204 GGAAGAATCCCAACCCCTGACGG + Intergenic
928861452 2:35862105-35862127 TGAAAAATTACATCCACTGATGG + Intergenic
929609867 2:43263056-43263078 GGGAGAAGGACAAACACTAAAGG - Intronic
929979897 2:46668628-46668650 GGGAGAAGTCCAACCACAGTAGG - Intergenic
931550456 2:63439746-63439768 GGGGTAATTACCATCACTGATGG + Exonic
933374166 2:81458034-81458056 GGTAGAATTTCCACCATTGAGGG + Intergenic
938833159 2:135073439-135073461 AGGATAATCCCAACCACTGATGG - Intronic
944443502 2:199765868-199765890 AGGAGAATCACAACCACAGCAGG - Intronic
948142702 2:235685490-235685512 GGGAGCATTACAGCCTCTGCTGG - Intronic
948260693 2:236602317-236602339 TGGAGATTTACAACAACTGGCGG + Intergenic
1170206942 20:13808602-13808624 GAGAGAACTAGAACCAATGATGG + Intronic
1170809334 20:19661475-19661497 GTGAGAACTACACCCACTCAAGG + Intronic
1170812069 20:19681808-19681830 GGGAGAATGGAAAACACTGATGG + Intronic
1177944487 21:27450495-27450517 GGGAGGATTAAAGCCAGTGAAGG - Intergenic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
951632254 3:24734924-24734946 AGGAAAATAACACCCACTGAAGG - Intergenic
953372815 3:42404988-42405010 GGGACATTAACAACCACTTACGG - Intronic
953517507 3:43609522-43609544 TGGAGAATTCCAACCATTTACGG + Intronic
956662801 3:71615750-71615772 GGGTCAAGTACAATCACTGAAGG - Intergenic
956943403 3:74191560-74191582 TGGAGAATTATAACAACTGAAGG - Intergenic
968024395 3:195427113-195427135 GGGAGTATCACAACCACTGCTGG + Intronic
970826419 4:20281403-20281425 GGGAGAATTACAGAAAATGATGG - Intronic
975547545 4:75575069-75575091 AGGTGAATGACAAGCACTGATGG - Intergenic
976921015 4:90442959-90442981 GGGGGACTTACATCCACTGGGGG - Intronic
979655771 4:123191769-123191791 AGGAAAATGACAACCACTCATGG - Intronic
985131756 4:186745566-186745588 GGGAGAACTGCTGCCACTGAAGG + Intergenic
987400206 5:17467228-17467250 GGGAGTTTTAAAACTACTGATGG + Intergenic
987433371 5:17863611-17863633 GGGAAACTTGAAACCACTGAAGG + Intergenic
988193197 5:27965091-27965113 GGTAGAACTGCTACCACTGAGGG - Intergenic
989530898 5:42507248-42507270 GGGATACTTACAACGACTAATGG - Intronic
990359874 5:55007518-55007540 GGGAGAATTCATACCACTGTAGG - Intronic
991977310 5:72196035-72196057 GAGGGAATCACTACCACTGAAGG + Exonic
993820853 5:92614685-92614707 GGGAGACCTAAAACTACTGATGG + Intergenic
994913214 5:105940491-105940513 GGAAGAAGTACAACCAGTAAAGG - Intergenic
995181460 5:109234467-109234489 GGAAGGCTGACAACCACTGAAGG + Intergenic
995724867 5:115171235-115171257 TGTAGAATTAAAAACACTGAGGG + Intronic
997174247 5:131757611-131757633 GGAAGAATTACGGCCTCTGAAGG + Intronic
998964676 5:147526480-147526502 GGGAGAATTACAAGTATTGTAGG - Intergenic
999507526 5:152213615-152213637 GGGAGAAATAGGACGACTGAGGG + Intergenic
999879663 5:155847752-155847774 TGGAGAGTTAGAACGACTGAGGG - Intergenic
1000794548 5:165648702-165648724 AGGAGAAATTCCACCACTGAGGG - Intergenic
1002342990 5:178528831-178528853 GGGAGAAGTGCAAGCATTGAGGG - Intronic
1010037411 6:71342266-71342288 GGGAGAATTAAATCCAGTTAAGG - Intergenic
1013159104 6:107523992-107524014 GGGAGATTGTCAACCACTGTGGG + Intronic
1017498346 6:155001190-155001212 GGGAGAATCACATCCAGTAAAGG + Intronic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1022358102 7:29634842-29634864 GTGAGAATTACAACTAATAAAGG - Intergenic
1022418349 7:30197520-30197542 GACAGAATTCCAACCTCTGATGG - Intergenic
1024120705 7:46235529-46235551 GGGAGCCTCACTACCACTGAGGG - Intergenic
1024413106 7:49070313-49070335 GAGACAATTACTACTACTGAGGG - Intergenic
1028300027 7:89187203-89187225 GGGTCAATTCCAACCACTAAGGG - Intronic
1028718933 7:94006956-94006978 GGGAATATTACTAGCACTGATGG + Intergenic
1031768719 7:125814414-125814436 GATAGAATTACAGCCACAGAAGG - Intergenic
1033609887 7:142954735-142954757 GTGAGTATTACAACCAGTGTGGG + Intronic
1037128702 8:15382306-15382328 GGGAATATAACAACCACTGGTGG - Intergenic
1037413878 8:18627334-18627356 GGGAGAGTTACAAAAACAGATGG + Intronic
1037929886 8:22872610-22872632 GGAAGACTTAAAACCATTGAAGG - Intronic
1047858853 8:128942171-128942193 TGGACAAATACAACCACAGAAGG + Intergenic
1057093325 9:92280859-92280881 GGGAAAGTTACAAATACTGAAGG + Exonic
1059512328 9:114861068-114861090 TGGGGCAATACAACCACTGAAGG - Intergenic
1185558778 X:1042632-1042654 GGGAGAACTGGCACCACTGAGGG + Intergenic
1192923757 X:75734734-75734756 GGGAGGTTTAAAACCGCTGATGG + Intergenic