ID: 1129141068

View in Genome Browser
Species Human (GRCh38)
Location 15:73598400-73598422
Sequence AATTATGGGCAATTAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129141068_1129141075 16 Left 1129141068 15:73598400-73598422 CCTACCTCTAATTGCCCATAATT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1129141075 15:73598439-73598461 TCCATAAGACAAGGTGGAAATGG 0: 1
1: 0
2: 3
3: 47
4: 251
1129141068_1129141073 7 Left 1129141068 15:73598400-73598422 CCTACCTCTAATTGCCCATAATT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1129141073 15:73598430-73598452 GGTTACACTTCCATAAGACAAGG 0: 1
1: 0
2: 1
3: 2
4: 108
1129141068_1129141074 10 Left 1129141068 15:73598400-73598422 CCTACCTCTAATTGCCCATAATT 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1129141074 15:73598433-73598455 TACACTTCCATAAGACAAGGTGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129141068 Original CRISPR AATTATGGGCAATTAGAGGT AGG (reversed) Intronic
902097030 1:13954731-13954753 AATTATGGGCAATTGCATGGAGG - Intergenic
910335575 1:86126350-86126372 AATTATGGGTAATAAGAAATAGG + Intronic
913372194 1:118112683-118112705 AGTTATTTGCAATTAGAGGCCGG + Intronic
921564925 1:216705523-216705545 AAATATGGGCAATTCCAGGTAGG - Intronic
1064372451 10:14764500-14764522 AATTTTAGGCAGTTAGAGGAAGG - Intronic
1068700611 10:60015804-60015826 AATCTTGGGGAATTAGGGGTCGG - Intergenic
1070204421 10:74242570-74242592 AATTATAGGCAAATAGGGGTGGG + Intronic
1071860704 10:89669802-89669824 AGTTCTGGCCAATTAGATGTGGG - Intergenic
1071865110 10:89721014-89721036 AGTTATGGCCAATTAAAGATGGG - Intronic
1074666921 10:115737981-115738003 AACTATGTGCAATTAGGGATTGG - Intronic
1075251579 10:120880808-120880830 AAATATTTGCAATTAAAGGTAGG + Exonic
1080372130 11:31662099-31662121 AATTAAGGACAATTATATGTAGG + Intronic
1083045441 11:59730645-59730667 AATTATGGGCAATTAGACAAAGG + Intronic
1084487611 11:69459347-69459369 ACATATGGGTCATTAGAGGTTGG + Intergenic
1084861309 11:72020114-72020136 AAGAATGGGTGATTAGAGGTAGG - Intronic
1088069117 11:105759393-105759415 TTTTAGGGGCAATTAGAGGAAGG - Intronic
1091227576 11:133966709-133966731 ATTTATGGGCATTTAGAGAAGGG + Intergenic
1097357355 12:58616577-58616599 AATTCTGTGCACTTTGAGGTTGG - Intronic
1099730012 12:86488905-86488927 AATTCTGGGCAGACAGAGGTGGG + Intronic
1101040868 12:100754239-100754261 ATTGATGAGCAATTAGATGTGGG - Intronic
1106976064 13:35217440-35217462 AATTTTGGGAAAGTAGAGGTAGG - Intronic
1114438411 14:22726909-22726931 TATTATGGGTGATTAGAGTTAGG - Intergenic
1116115133 14:40638499-40638521 ATTTATAGGCAAATAGAAGTGGG + Intergenic
1118231933 14:63959925-63959947 AATTATGGGCAATTATGCGGAGG - Intronic
1121614395 14:95303439-95303461 ACTGATGGGCAATTAGGGGCCGG + Intronic
1122662109 14:103303384-103303406 AATTATAGGCAATTAGAAGCGGG + Intergenic
1125804042 15:42477440-42477462 TAATATGGGAAACTAGAGGTGGG - Intronic
1125860356 15:42993328-42993350 AAGTATGAGGAATTAGAGATTGG + Intronic
1127879586 15:63144890-63144912 TCTTATTGGCAATTAGAGGAAGG - Intronic
1129141068 15:73598400-73598422 AATTATGGGCAATTAGAGGTAGG - Intronic
1130423825 15:83775282-83775304 AATAATTTGCAATTAGTGGTAGG + Intronic
1131064881 15:89428021-89428043 AGATATGGGCAAATATAGGTGGG + Intergenic
1133462413 16:5998718-5998740 AATTATGGACAATCAGAGACTGG - Intergenic
1137770286 16:51010967-51010989 AATTATGAGCAATTTAAAGTAGG + Intergenic
1146137855 17:30338849-30338871 AATAAAGGGGAATGAGAGGTTGG - Intergenic
1146715176 17:35079989-35080011 AATTATGTGCAAGCAGGGGTGGG - Intronic
1148434159 17:47668799-47668821 AATTATGGGGAATCAGTGCTAGG - Intronic
1150850748 17:68701650-68701672 AATGATGTGGAATTAGAGGCAGG + Intergenic
1153720326 18:7895200-7895222 GATTAGGGGTAATTAGGGGTTGG + Intronic
1155090098 18:22499931-22499953 TAATATGGGCAATCAGAGGGAGG + Intergenic
1157573341 18:48728158-48728180 TATTATTGGGAATTAGAGGAAGG - Intronic
1159529604 18:69638862-69638884 AATTATGGCTAGTTAGAAGTGGG + Intronic
1163050840 19:14682548-14682570 ATTTTTGGGGAGTTAGAGGTTGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
925345608 2:3170127-3170149 AATTAGGTGCAATTGGATGTGGG - Intergenic
925950857 2:8909953-8909975 AGAAGTGGGCAATTAGAGGTGGG - Intronic
926425051 2:12732527-12732549 ATTTGTGGGCCATTTGAGGTAGG + Intronic
926881942 2:17555309-17555331 ACTTTTGGGCAATTGCAGGTAGG - Intronic
929179155 2:39015463-39015485 AAATAAAGGCAATTAAAGGTTGG - Intronic
929720223 2:44360974-44360996 AATAATGGGCGATTGGGGGTAGG + Intronic
933394815 2:81717730-81717752 TATTATGGGGAGTTAGAGGGTGG + Intergenic
939740995 2:145906194-145906216 GAATATGGGGAATAAGAGGTTGG - Intergenic
942738398 2:179142773-179142795 GGTTATGGGCAATTATAGGATGG - Intronic
944836740 2:203587623-203587645 AATTTGGAGGAATTAGAGGTTGG + Intergenic
944861274 2:203818032-203818054 AATTATAGAACATTAGAGGTGGG - Intergenic
1170065023 20:12301656-12301678 GATTATGAGTATTTAGAGGTGGG + Intergenic
1170070848 20:12365110-12365132 AATTATGTGCAATATGAAGTTGG - Intergenic
1174160809 20:48549168-48549190 ACTTGTGTGCAATTAAAGGTGGG - Intergenic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1177770040 21:25503984-25504006 AAGAATGGGCTAATAGAGGTGGG + Intergenic
1181007161 22:20019320-20019342 GTTTGTGTGCAATTAGAGGTTGG + Intronic
951379183 3:21962116-21962138 TATTATGGGCAATAAGAGGAAGG + Intronic
953310239 3:41870582-41870604 CATTATGGGAAACTAGAGGAAGG - Intronic
955080608 3:55654940-55654962 AAGAATGGGCAGTTAGAGGTTGG - Intronic
956729576 3:72184577-72184599 AATTATGGCCAATTAGCCTTGGG + Intergenic
957017623 3:75086886-75086908 TATTATGGGCAATTATATGGAGG - Intergenic
957968942 3:87358664-87358686 GATTATGGGAAATTAAAGGCAGG + Intergenic
959211003 3:103380754-103380776 AATGATGGGGAATGGGAGGTAGG - Intergenic
959576662 3:107941625-107941647 ATTTCTGGGCAATTAGAGGCAGG - Intergenic
959898825 3:111636959-111636981 AATTATGGCCACTTAGAAGCAGG - Intronic
960245474 3:115395470-115395492 AATCAGGAGCAGTTAGAGGTGGG - Intergenic
960856437 3:122107119-122107141 ATTTATGGGCATTCAGAGGTAGG + Intronic
964095114 3:152922345-152922367 AATTAAGGGCCATTAGATGTGGG - Intergenic
965457781 3:168925308-168925330 AATTATGTACAATAAGTGGTGGG - Intergenic
966108734 3:176370137-176370159 AAATATGGTCATTTAAAGGTAGG - Intergenic
970420087 4:15897952-15897974 AATTATTGGCCATTGGAGATTGG + Intergenic
971941064 4:33215808-33215830 TATTATGGCTAAGTAGAGGTAGG + Intergenic
975701499 4:77071179-77071201 AATTATAGGCAATTGGAGAACGG - Intronic
976382959 4:84421076-84421098 AACAAAGGGCAATTAGATGTGGG + Intergenic
980720213 4:136685990-136686012 AATTATGGGGAATGGGAGTTGGG + Intergenic
982407305 4:155034727-155034749 AATGATGGGCCATTAGAGCAGGG + Intergenic
984290763 4:177791007-177791029 AATTATGGACATTTATAGTTTGG + Intronic
987252690 5:16116466-16116488 AATTCTCTGCAATTAGAGGGTGG - Intronic
991122760 5:63034488-63034510 CATTATGAGCAACTTGAGGTAGG - Intergenic
992577540 5:78133058-78133080 AAACATGGGAAGTTAGAGGTTGG - Intronic
993822466 5:92635861-92635883 AATTATTGTCAAGAAGAGGTGGG + Intergenic
994158175 5:96526332-96526354 AATTATGGGAAGGTAGAGGTAGG + Intronic
996364956 5:122691500-122691522 AATGATGTGTGATTAGAGGTGGG - Intergenic
999332910 5:150689441-150689463 AATTATGAGCAATTATATCTTGG - Intergenic
1000171854 5:158709910-158709932 CATTATGTGTATTTAGAGGTGGG + Intronic
1000602764 5:163295133-163295155 ATTTCTGGGGATTTAGAGGTAGG + Intergenic
1003012148 6:2436111-2436133 AATTATCGGCACTCAGAGGGGGG - Intergenic
1003714525 6:8631736-8631758 AGTTATGGGCAATGAGAACTTGG + Intergenic
1005146715 6:22699970-22699992 AAATATGGCTAATTAAAGGTAGG + Intergenic
1005623794 6:27644672-27644694 AATTGAGGTCAATCAGAGGTGGG - Intergenic
1006215617 6:32440015-32440037 AATCATGGGCTATCAAAGGTAGG + Exonic
1010601288 6:77829766-77829788 AATTAAAGGAAATTAGAGATAGG + Intronic
1014521738 6:122452099-122452121 AATTATTAGCAATTAGAAATGGG + Intronic
1015621226 6:135134146-135134168 AAATATGAGGAATTAGATGTTGG + Intergenic
1016069552 6:139723853-139723875 AATTCTAGGCAAATAAAGGTAGG - Intergenic
1020435889 7:8161954-8161976 AATGATGGGATATTTGAGGTGGG + Intronic
1022645836 7:32227908-32227930 AATGATGGGCAAATTGATGTTGG - Intronic
1023492680 7:40761403-40761425 AATTATGGGAAATTAGAGAGGGG + Intronic
1023515878 7:41001225-41001247 ATTTAAGGTCAATTAGAGGAGGG + Intergenic
1027482489 7:78716464-78716486 AATTAATGGCAATTAGTGGGTGG + Intronic
1028361885 7:89977660-89977682 AATTAAGGGCAATTTGAGCCTGG + Intergenic
1030648687 7:112093267-112093289 ATTTATGGGGAATGGGAGGTGGG - Intronic
1032707873 7:134437662-134437684 AATTATTGGAAAGTAGATGTGGG - Intergenic
1034071763 7:148193225-148193247 AATTATAGGCTTTTAGAGGGAGG + Intronic
1036581169 8:10077214-10077236 AATGATGGGCAAAGAGAGGGAGG + Intronic
1036935357 8:12996891-12996913 AAATGTGGGCCATTAGAAGTGGG - Intronic
1038886394 8:31667501-31667523 AATTATGGGCAAGTACATGCAGG + Intronic
1039171513 8:34752534-34752556 AATTATGAGCAATTAGAACTCGG + Intergenic
1040763908 8:50883168-50883190 AATTTTAGGCATTAAGAGGTTGG - Intergenic
1041023391 8:53660034-53660056 AAGTATGGACAATTACAGGCCGG + Intergenic
1045468833 8:102493075-102493097 AATTATGGATAATTGGAGGAGGG - Intergenic
1046305980 8:112367547-112367569 CTTTATGGCCAATTAGATGTTGG - Intronic
1048684815 8:136892652-136892674 CATTATGGGCAAGCTGAGGTAGG + Intergenic
1048691064 8:136963893-136963915 AATAATGGTCATTTTGAGGTTGG - Intergenic
1051499743 9:17764135-17764157 CATTACAGGCAATTCGAGGTTGG + Intronic
1061681047 9:132242540-132242562 AATTGTAGGCAACTGGAGGTCGG - Exonic
1185830085 X:3293061-3293083 CATTTGGGGCAATGAGAGGTTGG + Intergenic
1190734043 X:53243506-53243528 AATTATGGGCACTGGGTGGTAGG + Intronic
1191781638 X:64874545-64874567 AAGTATGAGCAATTAGGGGTAGG + Intergenic
1197832079 X:130653782-130653804 AATAATGGAAAATAAGAGGTGGG + Intronic
1198720409 X:139612150-139612172 ATTTTTGATCAATTAGAGGTAGG + Intronic
1199834118 X:151571628-151571650 AATTCTTGTCAAATAGAGGTTGG + Intronic
1200204041 X:154303148-154303170 AAAAATGGGGAATGAGAGGTAGG - Intronic