ID: 1129142695

View in Genome Browser
Species Human (GRCh38)
Location 15:73614957-73614979
Sequence GTTTGTTTTCTAACAAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129142691_1129142695 11 Left 1129142691 15:73614923-73614945 CCTTTTGTTTAAAAAAATCAAAT 0: 1
1: 0
2: 25
3: 302
4: 2530
Right 1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG 0: 1
1: 0
2: 3
3: 35
4: 296
1129142690_1129142695 23 Left 1129142690 15:73614911-73614933 CCTTAGAAGTTACCTTTTGTTTA 0: 1
1: 0
2: 0
3: 30
4: 301
Right 1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG 0: 1
1: 0
2: 3
3: 35
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129142695 Original CRISPR GTTTGTTTTCTAACAAGCAA GGG Intronic
904860654 1:33535330-33535352 GATTGTTTTTTAACAAGGCAAGG - Intronic
906264646 1:44418624-44418646 TTTTGTTTTCAAACAAAAAAGGG - Intronic
906754958 1:48302904-48302926 GTTTGTTGGCAAACAAGCAAGGG - Intronic
907832718 1:58080289-58080311 GTTTGTTTTTTAATACCCAAAGG + Intronic
908141628 1:61191044-61191066 TTTTTTTTTCAAGCAAGCAAGGG + Intronic
908749953 1:67412167-67412189 TTTTGTTTTAGAACAAGGAAGGG + Exonic
908818116 1:68054528-68054550 GTTTTTTTCCTTACAGGCAAAGG - Intergenic
910272818 1:85415330-85415352 ATTTATGTTCTCACAAGCAATGG - Intronic
910717323 1:90246407-90246429 ATTTCTTTTATTACAAGCAATGG + Intergenic
911034406 1:93525241-93525263 GTACTTTTTCTAACAAGCACAGG - Intronic
911227390 1:95321280-95321302 ATTTCTTTTCTAAGACGCAAAGG - Intergenic
911443651 1:97963072-97963094 GTTTCCTTTCTTCCAAGCAAAGG - Intergenic
911904196 1:103546231-103546253 TTTTGTTTTTTAATAAGAAATGG + Exonic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
917144960 1:171880161-171880183 GTTTGTTTTCTAGCCATCACAGG - Intronic
920807621 1:209250046-209250068 GTTTGGTTTATAAAAAGAAAGGG + Intergenic
921489047 1:215751945-215751967 TATTGTTTTCTAACATGGAATGG - Intronic
921795633 1:219340877-219340899 ATTTGTTTTGTAACAAGAGAGGG + Intergenic
921857806 1:220007166-220007188 GTTTGTTTTCAAATAAACATAGG - Intronic
922747814 1:228055868-228055890 GTTTGTTTTCTGCAAAGCACAGG + Intronic
924300982 1:242637417-242637439 TTTTGTTATCTCACAAGCAGAGG + Intergenic
924586413 1:245364854-245364876 GTTTTTTTTCACATAAGCAATGG - Intronic
924745372 1:246828361-246828383 GTTTGTTTTATTACAAACACAGG - Intergenic
1063545480 10:6976773-6976795 ATTTATTTTCTAACTAACAAGGG + Intergenic
1064094589 10:12413765-12413787 TTTTTTTTTCAAACAAACAATGG - Intronic
1064257047 10:13751204-13751226 ACTTGTTTGCCAACAAGCAAGGG - Intronic
1064921483 10:20523988-20524010 ATTTGCTTTCTGATAAGCAATGG - Intergenic
1065653400 10:27918898-27918920 GTTTTTTTTTTTACAAGTAATGG - Intronic
1067008590 10:42689905-42689927 GTTTGCTTTTTCCCAAGCAATGG - Intergenic
1067217552 10:44315741-44315763 GTTCTTTTTCTTACAAGCATGGG + Intergenic
1068223782 10:54079419-54079441 GTTTGTTTTGTCACTAGCACGGG - Exonic
1070472208 10:76792329-76792351 GTTTGTTTTATAGAAAACAAAGG - Intergenic
1070733275 10:78846312-78846334 GTCTGTTTTCTAACCATCTAGGG + Intergenic
1071211330 10:83344988-83345010 GTTTGGCATCTCACAAGCAAAGG - Intergenic
1071978603 10:90980357-90980379 TTTTGTTTTGTAACAATTAAAGG + Intergenic
1073459185 10:103656325-103656347 GATTGTTTTCTCACCAGCAATGG - Intronic
1074301411 10:112236452-112236474 GTCTTTTTGCTAATAAGCAAAGG + Intergenic
1074663466 10:115690505-115690527 GCCTGGTTTCTAACAAGCCACGG + Intronic
1075411379 10:122231061-122231083 GTTTGTTTTTTTACAAAAAACGG + Intronic
1079159384 11:17978065-17978087 CTTTGCTTTCTAACTAGCTATGG + Intronic
1079539718 11:21558282-21558304 GATTTTTTTTTAAAAAGCAACGG - Intronic
1079625557 11:22612726-22612748 GTTTGATTCCTAACAGGCCATGG + Intergenic
1080015187 11:27498549-27498571 GTTTGTTTTCTTACAATCATTGG + Exonic
1080058866 11:27935669-27935691 GTTTGTTTTCTCATTTGCAAAGG - Intergenic
1080124725 11:28719650-28719672 GTTTGTTTACTAACATGAAAAGG - Intergenic
1080550500 11:33370545-33370567 GTTTGTTTTTTAACGATCAAAGG - Intergenic
1081283337 11:41238595-41238617 ATTTATTATCTCACAAGCAAAGG - Intronic
1081514921 11:43818876-43818898 CTTTATTTTTTAGCAAGCAAAGG + Intronic
1085615151 11:77992089-77992111 ATTTGTTTTCTAATAAAGAATGG - Intronic
1086254358 11:84856946-84856968 GTATGTTTTGTCACAAGCCAAGG + Intronic
1087055795 11:93934766-93934788 GGTTGTGTTCTAATCAGCAAAGG + Intergenic
1087506273 11:99026695-99026717 GTTTCTTCACTAATAAGCAAGGG + Intronic
1089447435 11:118564818-118564840 GTTTGTTTTCTGACTAGTTAAGG - Intronic
1091000126 11:131903946-131903968 TTTTGTTTTTTGACAAACAAAGG + Intronic
1092634206 12:10423649-10423671 ATTTATTTTCTATCAAGAAAAGG + Intronic
1092635253 12:10439053-10439075 ATTTATTTTCTATCAAGAAAAGG + Intronic
1093250301 12:16794594-16794616 TTTTGTTTTCTAAAAACCAGAGG + Intergenic
1095307953 12:40660334-40660356 GTTTGTTTTCACACATGTAAAGG - Intergenic
1097255480 12:57670437-57670459 GTTTGTTTTCTAATAGAGAAAGG - Intergenic
1097633728 12:62096460-62096482 ATTTGTTTTTTAAAAAGCAGAGG + Intronic
1097684742 12:62680801-62680823 GTTTGTTTTGTAACCAAAAAAGG + Intronic
1098910369 12:76203029-76203051 GTTTGTTTAGTAGCAACCAAAGG + Intergenic
1099553404 12:84076875-84076897 TTTTTTTTTTTAATAAGCAATGG - Intergenic
1100320290 12:93484945-93484967 GTGTGTTTTTTAAAAAGCAATGG - Intronic
1100497008 12:95134855-95134877 CAGTGTTTTCTAAGAAGCAAGGG + Intronic
1101439791 12:104694965-104694987 CTGTGTTTTCTACCCAGCAAAGG - Intronic
1102985142 12:117271899-117271921 GTGTCTTTTCTAAAAAACAAGGG - Intronic
1105058255 12:133123700-133123722 GTTTTTTTTTTTTCAAGCAAAGG - Intronic
1106911980 13:34472528-34472550 GGTTGTTATCTATCAAGGAAGGG + Intergenic
1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG + Intronic
1107715166 13:43192537-43192559 GCATGCTTTTTAACAAGCAACGG + Intergenic
1108044029 13:46366046-46366068 ATTTGTTTACTAACTAGAAACGG + Intronic
1108049017 13:46411211-46411233 GATTCTTTTCAGACAAGCAAAGG + Intronic
1110233344 13:73190137-73190159 GTTTGTTTTTTTAAATGCAAAGG + Intergenic
1110309155 13:74026954-74026976 CTTTGGTTTCTAACAGGAAATGG + Intronic
1110465385 13:75794370-75794392 GTTTGTTTTCTGGAAAGGAATGG + Intronic
1111120783 13:83846256-83846278 GTTTGTTTTTCAACAAGGCATGG - Intergenic
1111150472 13:84247148-84247170 TTTTGCATTCCAACAAGCAATGG - Intergenic
1112422950 13:99269499-99269521 TTTTGCTTTCTTATAAGCAAGGG + Intronic
1113064609 13:106360430-106360452 GTTTGCTTTATAACAGGTAAGGG + Intergenic
1114853442 14:26408468-26408490 GTTTGTTTGCTAAGCAGCAGTGG + Intergenic
1116150196 14:41130525-41130547 CTATATTTTCTAACCAGCAATGG + Intergenic
1116402824 14:44529892-44529914 GTTTCTTTAATAAGAAGCAAAGG + Intergenic
1116438920 14:44928535-44928557 ATTTGTTTTAAAACAAACAAAGG - Exonic
1117091971 14:52260679-52260701 GTATCTTATCTAAGAAGCAAAGG - Intergenic
1117194364 14:53324675-53324697 GTATGTTTTGTTATAAGCAACGG - Intergenic
1117642172 14:57811574-57811596 CTTTGTTTTCTAAAGAGAAAAGG + Intronic
1118254980 14:64197853-64197875 GTTTTTCTTTTAACTAGCAATGG - Intronic
1120468315 14:84890063-84890085 GTTTATTTCCTAACATGCCATGG + Intergenic
1122441191 14:101733211-101733233 GAGTGTTTTGTAACAAGCATTGG + Intergenic
1124894802 15:33766468-33766490 GTGTGTTTTGTAAGAAGCTAGGG + Intronic
1125431123 15:39594385-39594407 GTTTGTCTTCTCTCAAGAAATGG + Exonic
1127383057 15:58445849-58445871 GTTAGTTTTGTGACCAGCAATGG - Intronic
1127510769 15:59638647-59638669 TTTTGTATTTTAAAAAGCAAGGG + Exonic
1129090806 15:73148417-73148439 GTTTGATTTTTAGCAAGAAAGGG - Intronic
1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG + Intronic
1129913555 15:79247865-79247887 GTTTGTTGTCTGTCAAGCACAGG - Intergenic
1130759192 15:86800080-86800102 GCTTGTTTACTAATAAGTAATGG + Intronic
1133633982 16:7648880-7648902 GTATGATTTCAATCAAGCAAGGG - Intronic
1133665343 16:7961834-7961856 GTTTGATGTCTAAAAAGCATAGG + Intergenic
1133823120 16:9254424-9254446 GTTTTTTTTCTGACCAGCACAGG + Intergenic
1133849339 16:9487300-9487322 TTTTTTTTTCTAAAAAGTAAGGG + Intergenic
1133967297 16:10540628-10540650 GTTTGTTTTTTAACATGAAAAGG + Intronic
1137849261 16:51722400-51722422 GTTTATTTTCTAAGAAGCCCTGG + Intergenic
1137856869 16:51803462-51803484 ATTTGTTTTCTTAGAATCAATGG + Intergenic
1138082685 16:54105952-54105974 GTATGTTTTCTTAAAATCAATGG + Intronic
1138832616 16:60393494-60393516 GTATGTTTTCTAACATGGAGTGG - Intergenic
1141500417 16:84440394-84440416 CTTTATTTTCAAACAAGCACTGG - Intronic
1145407503 17:22617674-22617696 GTTTGTTTTGTAACATGAAGTGG + Intergenic
1145723329 17:27091847-27091869 TTTTGTTTTATACCAAGCAACGG + Intergenic
1147028586 17:37610504-37610526 GTTTGCTTGCTAACAAGTAATGG + Exonic
1149435271 17:56628636-56628658 TTTTGTATTCTGACATGCAAAGG - Intergenic
1150464939 17:65384689-65384711 GGGTATTTTCAAACAAGCAAGGG - Intergenic
1153171835 18:2325617-2325639 TTTTGTTATCTTACAAGCAGAGG - Intergenic
1153590116 18:6665017-6665039 GTTTGTTTTCTAATCAGCAAAGG - Intergenic
1155296406 18:24388466-24388488 TTTTTTTTTCTAATAAGCCATGG + Intronic
1156061874 18:33087533-33087555 GTGTGTTTTCTAAGAAACAGGGG + Intronic
1156285912 18:35695697-35695719 ATTTGTTTTCAAACAAGTGAGGG + Intronic
1157941671 18:51935486-51935508 GCTTGCTTTGTAACAAGCATTGG + Intergenic
1157991840 18:52505960-52505982 ATGTGTTTTCTCACAACCAAAGG - Intronic
1158390109 18:57038084-57038106 GTCTCTTTTCTAACAAGTGAAGG + Intergenic
1158842648 18:61404804-61404826 TTTTTTTTTTTAACAAGCACTGG + Intronic
1160320241 18:77884486-77884508 GATTGTTTTTTAAAATGCAAAGG - Intergenic
1161734857 19:5985499-5985521 TTTTGTTATCTTACAAGCAGAGG + Intergenic
1165225017 19:34348766-34348788 ATTTGTTTTAGAAAAAGCAAGGG - Intronic
1165673843 19:37704466-37704488 GTTTGTTTTCTAAACAGTTAAGG - Intronic
1166916533 19:46199287-46199309 GTTGTTTTTCTGACAAGTAAGGG - Intergenic
1168012876 19:53547816-53547838 GTATGTGTTCTATCAAGAAATGG + Intronic
1168352082 19:55681755-55681777 GGTTGTTTTCAGAAAAGCAAAGG + Intronic
1168496865 19:56860370-56860392 GTTTGTTTTCTAAGAAAAAGGGG - Intergenic
926517492 2:13867157-13867179 ATTTTTTTTTAAACAAGCAATGG + Intergenic
928402902 2:30992206-30992228 TTTTGTTTCCTAGCAAGCAGAGG - Intronic
930375938 2:50566615-50566637 GTTTGTTGTTCAACAAGCATGGG - Intronic
931619541 2:64195964-64195986 GGTTGTTTTCTAAACAGGAAAGG + Intergenic
931804970 2:65795604-65795626 GTTTTTTTTTTAACAAGGAAAGG - Intergenic
933106758 2:78337908-78337930 TTTTGTATTCTCACCAGCAATGG + Intergenic
933301546 2:80546472-80546494 GTTTTTTTTCCAACAAGTGAAGG + Intronic
933449317 2:82426607-82426629 GTTTTTTTTCTAAAAAGAGAGGG + Intergenic
933515793 2:83299552-83299574 GTTCATTCTATAACAAGCAAAGG + Intergenic
934723335 2:96597535-96597557 GATTCTTTTCCAACAAGCAAGGG - Intronic
937017992 2:118623716-118623738 GCCTGGTTCCTAACAAGCAATGG - Intergenic
937088009 2:119184603-119184625 GTATGTTTTATAATAAGCAAAGG + Intergenic
937901947 2:127026237-127026259 GTTTGTTTTATTTCAATCAATGG + Intergenic
938171573 2:129081971-129081993 TTTTGTTATCTTACAAGCAGAGG - Intergenic
940442310 2:153731888-153731910 GTTTGTTTTATATAAAGTAACGG + Intergenic
941182814 2:162281830-162281852 ATTTGTTTTGTAATAAGCCAGGG - Intronic
941322536 2:164073358-164073380 GATTGTTTTTTATCAAGCCAGGG - Intergenic
941395403 2:164967616-164967638 TTTTGTTTACTCACAAGCAAAGG - Intergenic
941912801 2:170781656-170781678 GTTTTTTTTCCCACAAGCATAGG + Intergenic
942514327 2:176736344-176736366 GTTTGTTATGCACCAAGCAATGG + Intergenic
942559167 2:177202110-177202132 GTTTGGTTGCTAACATGCCATGG + Intergenic
944036998 2:195307018-195307040 GTTTTTTGTCTCACAAGCTAAGG + Intergenic
944610161 2:201395522-201395544 TCTTGTTTTATAACAAGCACTGG + Intronic
945450190 2:209985341-209985363 GTCTATTTTCTTACAATCAATGG - Intronic
946011911 2:216572185-216572207 GTGTGCTTTGTAACAAGCAAGGG + Intronic
946565870 2:220965249-220965271 GTCTGTTTTCCAAAAGGCAACGG - Intergenic
947285565 2:228510822-228510844 GTTTGTTTTCTAACAAGTCATGG + Intergenic
947783068 2:232787711-232787733 GTGTTTTTCCTAACAAGAAAGGG + Intronic
1169939464 20:10920838-10920860 GTTTGTTTCCTAAAAAGCATGGG + Intergenic
1170141563 20:13130023-13130045 GTTTATTTTCAAAGAAACAAAGG + Intronic
1176947980 21:15007159-15007181 GTGGGTTTCCTTACAAGCAATGG + Intronic
1180645597 22:17336287-17336309 GTTTGTTATTTACTAAGCAAGGG - Intergenic
1182715085 22:32351826-32351848 GTTTTCTTTATCACAAGCAATGG - Intergenic
1183247150 22:36702835-36702857 GTTTTTTTTTTAAAAAGAAAAGG + Exonic
949646432 3:6100463-6100485 CTCTGTCTTCTAACATGCAATGG - Intergenic
949746215 3:7295269-7295291 GATTGTTGGCTAACATGCAAAGG - Intronic
950252623 3:11479599-11479621 GCATGTTTTCTAAAAAGGAAAGG + Intronic
950863505 3:16171071-16171093 GTCTGTTTTCTCATAAGCCATGG - Intergenic
951395194 3:22156598-22156620 GTTTGTATTCTAACATGTACTGG - Intronic
952223381 3:31348109-31348131 TTTTCTTATCTAACAAGCCAGGG + Intergenic
952339448 3:32433110-32433132 TTTTGGTTTGCAACAAGCAATGG - Intronic
954657575 3:52205553-52205575 GTTTCTTTTCTAAGAAACTAAGG - Intronic
955654892 3:61234522-61234544 GTTAGTTTTCTAACAGAAAATGG - Intronic
956015470 3:64877838-64877860 GTTTGTTTTTTTTAAAGCAATGG - Intergenic
956738018 3:72253566-72253588 GTTTATGTTCTCACCAGCAAAGG - Intergenic
956885596 3:73556372-73556394 GTGTGTTTTCCAACAGGAAAAGG - Intronic
956924669 3:73970886-73970908 GTTTGTTTTCTAAGTGGCTAGGG + Intergenic
957175640 3:76804406-76804428 GTCGGTTTTCTAACAAGGATAGG + Intronic
959077759 3:101768036-101768058 GTTTTTTTCCTAACAAGGAAAGG + Exonic
960321706 3:116244692-116244714 GTTTGTTTTCTAATAAGGAGGGG - Intronic
961958521 3:130829342-130829364 ATTTGTTTTCTAACAAAGAGCGG + Intergenic
964215721 3:154279265-154279287 GTTTGTGTTCCAACAAAAAAAGG + Intronic
964553800 3:157913707-157913729 GTTTAATTTATAAGAAGCAAGGG - Intergenic
965501904 3:169467137-169467159 GTTTGTTTTTTAACAGGGTAAGG + Intronic
965909292 3:173751966-173751988 GATTGTGTTTTAACAAGCACAGG - Intronic
965986430 3:174759365-174759387 TTTTGTCTTTTAAAAAGCAAGGG - Intronic
966366473 3:179193434-179193456 CTTTGTTTTCTAGCAATCAATGG - Intronic
966760392 3:183412915-183412937 GTTTGTTTTTTATCAAGATAGGG + Intronic
968345344 3:197999881-197999903 ATTTGTTTTCGAATAAGCAGGGG + Intronic
970510561 4:16777549-16777571 GGTTCTTTTCCTACAAGCAATGG + Intronic
970820064 4:20201401-20201423 ATTTGCTTTCTAAGAAACAAGGG + Intergenic
971121391 4:23709125-23709147 ATTTGATTTATAACAAGCATTGG - Intergenic
972075704 4:35083688-35083710 TTTTTTTTTCTACAAAGCAAAGG - Intergenic
973342172 4:49016711-49016733 GGTTGTTTTCGAGCAGGCAAAGG - Intronic
974319053 4:60320914-60320936 GTTTGTGTTTTTACAAGAAATGG - Intergenic
974525944 4:63050198-63050220 GTTTCCATTCTAACAAGTAAAGG - Intergenic
974688017 4:65256932-65256954 CTTTGTTTTATAACAAAAAAAGG + Intergenic
974779407 4:66533217-66533239 GTCTGCTTTCTAACATTCAATGG + Intergenic
977057338 4:92210443-92210465 AATTGTTTTTTAACAAGCATAGG + Intergenic
977543134 4:98342490-98342512 ATTTGTATTTTAACAAGGAAAGG + Intronic
979490570 4:121322319-121322341 GTTTGTTTTTTAACATGTGAAGG + Intergenic
979825483 4:125228139-125228161 CTTTTTTTTGTAATAAGCAAAGG + Intergenic
980232489 4:130062400-130062422 TTTTGTTTTGTATGAAGCAAGGG - Intergenic
980276922 4:130664956-130664978 TTTTGTTTTCCAAAAAACAAAGG - Intergenic
980634999 4:135490897-135490919 TTTTGTTTTCTGATAAGCAAAGG - Intergenic
980759193 4:137206408-137206430 GTTTCTTTTGTAACATTCAAGGG + Intergenic
982038223 4:151368243-151368265 GATTGTTTTTTAATAAGGAAAGG - Intergenic
982096717 4:151930198-151930220 GTTTGTTTTCGAAAAATAAAGGG - Intergenic
982956953 4:161782344-161782366 TTTTGTATTCCAGCAAGCAATGG + Intronic
983031936 4:162813714-162813736 TTTTGTTATCTTACAAGCGAGGG + Intergenic
983128337 4:163982618-163982640 GTTTGGTTTTTAACAAGGATTGG + Intronic
983445453 4:167844901-167844923 CATTGTTTTCTCACAAGCTAGGG + Intergenic
984253090 4:177358202-177358224 CTGTGTTTTCTAACAAGCTCCGG + Intronic
984264676 4:177483513-177483535 TTTTGTTTTCTCAGAAGAAAGGG - Intergenic
985011364 4:185585574-185585596 CTTTGAATTCTTACAAGCAAAGG - Intronic
985221662 4:187712657-187712679 GTTTTCTTTTTAACAAGAAAGGG + Intergenic
987778596 5:22401883-22401905 GTTATGTTTCTAACAAGCCAAGG + Intronic
988009986 5:25469373-25469395 GTTTGTTTTTCAGCAAGCAAAGG - Intergenic
988015699 5:25556315-25556337 GTTTGTTTATTTACAAACAATGG + Intergenic
989737381 5:44725039-44725061 GTTTGTTTCCTAAGAATCTATGG - Intergenic
991376580 5:65974350-65974372 GCTTGCTTTCTAATAATCAAAGG - Intronic
991552051 5:67849291-67849313 GGTTCTTTCCTAACAAGGAAGGG + Intergenic
992807148 5:80348670-80348692 TTTTCTTTTATAACAAGCTAAGG + Intergenic
993239530 5:85363432-85363454 GTGTGTTTTCAAACCAGGAAGGG + Intergenic
993925667 5:93862978-93863000 GTTTGTTTTCCTAGAAGTAAGGG + Intronic
994235498 5:97357934-97357956 GTTTGTTTACTAGAAAGTAAAGG - Intergenic
994643495 5:102440258-102440280 GCTTGTTTCCTAACAGGCAATGG - Intronic
996168753 5:120261749-120261771 GGTTTTGTTCTAAGAAGCAAAGG - Intergenic
996963253 5:129277132-129277154 GCTTGTTTTTTAAGAAGCCAGGG - Intergenic
999355228 5:150922518-150922540 GTTTGTCTTCTAACAATAATAGG + Intergenic
1000112399 5:158121348-158121370 CTTTGTTTCTTAACATGCAAAGG + Intergenic
1000368461 5:160512188-160512210 GTTTGATTTCTATCATGAAAGGG + Intergenic
1000404228 5:160869704-160869726 GTCTGTTTTCCAGCAAGCCATGG - Intergenic
1000627888 5:163559977-163559999 ATTTGTTATCTACCAAGCAGTGG + Intergenic
1000660165 5:163928501-163928523 TTTTGTTGTTTAACAAGTAAAGG - Intergenic
1000804546 5:165773300-165773322 CTCTGTTTTCTTACAAGTAAAGG - Intergenic
1001150810 5:169225834-169225856 GTTTGGTTTCTAAGAGCCAAGGG + Intronic
1003899980 6:10645647-10645669 GTTTGGTTCCAAAGAAGCAAAGG + Intergenic
1004138654 6:12993143-12993165 ATTTCTTTTCTAACAAAAAACGG - Intronic
1004293257 6:14387475-14387497 GTTTTTTTTTTAATAAGGAAAGG + Intergenic
1006601180 6:35227301-35227323 GTTTGTTTTCAAATAAAAAAAGG + Intronic
1007817779 6:44536873-44536895 GTCTGCTTTCTAAGAAGAAAGGG - Intergenic
1008030791 6:46690972-46690994 GTCTCTTTTCTACCAAGAAATGG - Exonic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1013263060 6:108466057-108466079 GTTTATTTTTTAACAAGGATTGG - Intronic
1013538964 6:111088402-111088424 GTTTGTTTTCAAACAATAAAAGG - Intronic
1014006058 6:116419415-116419437 GTTTGTTTCCAAACACACAAAGG + Intronic
1015029443 6:128576598-128576620 GTCTGTTTTACAACTAGCAATGG + Intergenic
1015503232 6:133953842-133953864 GTAAGTTTTCTGAGAAGCAACGG - Intronic
1015797664 6:137029197-137029219 GTTTATTTTCTAAAAGGTAAGGG - Intronic
1015819609 6:137246341-137246363 GCCTGGTTTCTAACAAGCCATGG + Intergenic
1016851008 6:148619070-148619092 GTTTCTTTTCTTGCAACCAAGGG + Intergenic
1016872357 6:148830989-148831011 ATTTCTTTTCTTTCAAGCAACGG - Intronic
1017040742 6:150306720-150306742 GCTTGTATTTTAAAAAGCAAGGG - Intergenic
1017458762 6:154628773-154628795 TTTTTTTTTTTAGCAAGCAATGG + Intergenic
1021822676 7:24513801-24513823 GTTTGTTCTCTGAAAAGGAAGGG + Intergenic
1022563047 7:31369719-31369741 CTTTTTTTTCTGACATGCAAGGG - Intergenic
1023458927 7:40372772-40372794 TAATGCTTTCTAACAAGCAAAGG + Intronic
1023529897 7:41141740-41141762 TTTTCTGTTCTATCAAGCAAGGG + Intergenic
1026572494 7:71543657-71543679 TTTTGTTATCTTACAAGCAGAGG + Intronic
1028201036 7:87961919-87961941 GTTTGTTTCCTTACAAGTGAGGG + Intronic
1028364679 7:90013504-90013526 GTTTGTTTCCATACCAGCAAAGG + Intergenic
1028854786 7:95578327-95578349 CTCTGCTTTCTAACAAGCCAGGG + Intergenic
1029551741 7:101240301-101240323 GTTTGTTTTTTAATAAGAGACGG + Intronic
1030341404 7:108384723-108384745 CTTTGCTTTCTAACAAGCTCTGG + Intronic
1030397046 7:108999021-108999043 CTGTGTTTCCTAACAAACAATGG - Intergenic
1030430850 7:109445837-109445859 CTTTGTTTTCTTACAAGCAAAGG + Intergenic
1030672425 7:112352156-112352178 GTTTGTTTTTTCATAAGGAAAGG - Intergenic
1031206541 7:118765166-118765188 GTTTGTTTTCAAACAATGAAAGG - Intergenic
1032906379 7:136372204-136372226 GTTTGTTTGTTAACAACAAATGG - Intergenic
1035037451 7:155904375-155904397 GGTTGTGTTCTTACAAGGAATGG + Intergenic
1036403077 8:8427698-8427720 TTTTCTTTTTTAAAAAGCAAAGG + Intergenic
1036763930 8:11534124-11534146 GTTTGTATTTTAACCAGCAGGGG - Intronic
1036979975 8:13459741-13459763 CTTTTTTTTCTAAAAATCAAAGG - Intronic
1037512343 8:19596416-19596438 GTTTGTTCTGTCACAAGCAGAGG - Intronic
1038219645 8:25595118-25595140 GTTTGTTTTGCAACCAACAAAGG + Intergenic
1039375510 8:37028742-37028764 GCCTGTTTTCTAACAGGCCATGG - Intergenic
1039655819 8:39404551-39404573 GTCTGCTTTCTAAGAAGCCATGG + Intergenic
1040572260 8:48621639-48621661 GATTGTTTTCTAAGAAAGAAAGG - Intergenic
1042050656 8:64701756-64701778 GTTTCTTTGGTAATAAGCAACGG + Intronic
1042531033 8:69815969-69815991 GGAAGTCTTCTAACAAGCAAGGG - Intronic
1043469933 8:80552035-80552057 GTTTGTTTTCTAACTTGTAAGGG + Intergenic
1044491502 8:92822763-92822785 GTTTGTTTTTTAACAAAAGAAGG + Intergenic
1044848039 8:96400699-96400721 TTTTGCATTCTCACAAGCAATGG - Intergenic
1045513120 8:102830509-102830531 GTTTCTTTTCAAATCAGCAAGGG + Intronic
1045748727 8:105456168-105456190 GTTTTTTTTTTAAGAAGGAAGGG + Intronic
1046415180 8:113904330-113904352 GTTTGTTCTCTAAATAACAATGG - Intergenic
1046854192 8:119010606-119010628 TTTTGCATTCTCACAAGCAATGG + Intronic
1047161393 8:122384269-122384291 GTTAGTTTTCCAACAAGCTAAGG - Intergenic
1048320061 8:133392345-133392367 GTTTGTTTTCTTTCAAGCCTAGG + Intergenic
1048534031 8:135275873-135275895 GTTTTATGTATAACAAGCAATGG + Intergenic
1048736073 8:137503507-137503529 GTTTTTTTTTTAAAAAACAAAGG + Intergenic
1050542848 9:6684899-6684921 GTTTGTTTGCTTACAAAAAAAGG + Intergenic
1050617530 9:7417868-7417890 TTTTTTTTTTTAACAAGGAAGGG - Intergenic
1050919055 9:11176237-11176259 TTTTGTTGTTTAAAAAGCAATGG - Intergenic
1051048943 9:12908797-12908819 TTTTGTTTTCTTTCAAGCACTGG - Intergenic
1051205707 9:14686649-14686671 GTTTAGTCTCTAAAAAGCAAAGG - Intronic
1051765828 9:20522678-20522700 GTTTTTTTTCTAAATTGCAAGGG + Intronic
1052429368 9:28347290-28347312 GTTTGTTTCCTCAAATGCAAGGG - Intronic
1052962137 9:34307952-34307974 GTTTGATTTTTCACAAGAAAAGG + Intronic
1054747457 9:68869171-68869193 GCTGGTTTCCTAACAAGCCATGG - Intronic
1056005579 9:82267272-82267294 TTTGGATTTCTAACAAGCAAAGG - Intergenic
1057928635 9:99174209-99174231 GGTTTTGTTCTAAAAAGCAAAGG - Intergenic
1058013892 9:100008595-100008617 GTTTGTTTTTTAAAAAATAAAGG - Intronic
1058233163 9:102456111-102456133 TTTTGTATTCTTACCAGCAAGGG + Intergenic
1058811955 9:108648420-108648442 GTTTGTTTTCTAACGAATGAAGG + Intergenic
1059583475 9:115578391-115578413 GTTTGCTTTCTAAGCAGCAGAGG - Intergenic
1059625172 9:116056293-116056315 GTTTCTTTTATAAAAAGCATTGG + Intergenic
1060625072 9:125104745-125104767 GTTTGTTTTTTGACAAACAAAGG - Intronic
1185951254 X:4436830-4436852 ATTTATTTTCTAACAAGAAAAGG + Intergenic
1186170961 X:6875904-6875926 GTTTGTTATTTGAAAAGCAATGG + Intergenic
1186343052 X:8663538-8663560 TTTTGTTATCTTACAAGCATAGG - Intronic
1187426883 X:19185844-19185866 GTTTGTTTTCTAATAAGGTAGGG + Intergenic
1188582373 X:31729608-31729630 GTAAGTTTTTTAACAAGCATGGG - Intronic
1189030607 X:37445733-37445755 ATTTGTTTTTTCACAAGCATGGG + Intronic
1191100035 X:56716831-56716853 GTTTTTTTTTTAACAAGAAGGGG - Intergenic
1192160842 X:68786092-68786114 GTTTGTTTTAGAACAAGGAAGGG - Intergenic
1193145810 X:78074585-78074607 GTTTGTTTTTAAAGAAGGAAGGG - Intronic
1193600006 X:83500395-83500417 GTTTGTTCTCCAATATGCAAAGG + Intergenic
1194039616 X:88923864-88923886 GTTTGTTTTTAAACAAACATGGG + Intergenic
1194678294 X:96819248-96819270 GTTACTTTTCAAAGAAGCAAAGG - Intronic
1195744275 X:108099090-108099112 TTTTGTATTCTCACCAGCAATGG + Intronic
1195813641 X:108861062-108861084 GTTGGTTTTCTCACATGCATTGG + Intergenic
1196348114 X:114691814-114691836 ATTTTTTTTCTAAGAAGCAGTGG - Intronic
1197403643 X:126025255-126025277 GTTTATTTTCTAAAAAGAACAGG - Intergenic
1197439992 X:126476111-126476133 GTTTGCATTCTCAGAAGCAATGG + Intergenic
1197549886 X:127877891-127877913 TTTTTTTTTCTAACAAGAAATGG + Intergenic
1198380829 X:136081873-136081895 GTTTATTTTCAACCCAGCAAAGG + Intergenic
1199911125 X:152287971-152287993 GTTTCTTTCTTAACAATCAATGG + Intronic
1200130736 X:153843258-153843280 GATTGATTGCTAACAAGTAAGGG - Intergenic
1200425160 Y:3012451-3012473 GTTTTTTATCTGACAAGAAAAGG - Intergenic
1201737817 Y:17288559-17288581 TTTTATTTTCTAACAAGAAAAGG + Intergenic
1201853231 Y:18511936-18511958 TTTTGTTTTCTACCAACCAATGG + Intergenic
1201880090 Y:18808448-18808470 TTTTGTTTTCTACCAACCAATGG - Intronic
1202026435 Y:20528648-20528670 CTTTGTTTACCAACCAGCAATGG - Intergenic