ID: 1129143966

View in Genome Browser
Species Human (GRCh38)
Location 15:73631897-73631919
Sequence GAGAAGATGGAGAAGTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 704}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129143966 Original CRISPR GAGAAGATGGAGAAGTGGTG GGG (reversed) Intronic
900023166 1:199481-199503 GGGAAGACGCAGAAGTGGGGAGG + Intergenic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900486302 1:2924365-2924387 GAGAAGACAGAGAGGTGGAGGGG - Intergenic
900572603 1:3366079-3366101 GGGAAGATGGCGAAGAGGTGAGG + Intronic
900578292 1:3394932-3394954 GAGGAGATGTAAAAGTGGAGAGG - Intronic
900803256 1:4750804-4750826 GAGAAGAAGGAGGAGTGAGGTGG + Intronic
900911764 1:5601657-5601679 TGGAAGATGCAGATGTGGTGTGG + Intergenic
902050707 1:13561780-13561802 GAGAAGATGGGGGAATGGAGGGG - Intergenic
902544046 1:17175260-17175282 GAGAATATGGACAGGTGGGGTGG - Intergenic
904308095 1:29603484-29603506 AAGAAGATGGAGAATTCATGTGG - Intergenic
904424240 1:30413338-30413360 GAGAAGCTGGCGAAGAGGGGAGG + Intergenic
904606826 1:31702569-31702591 GAGAAGTTGGAATAGTGATGAGG + Intronic
904621292 1:31776869-31776891 GAGAAGATGGGGAAGATCTGGGG + Intergenic
905006546 1:34714454-34714476 GGGCAGAAGGAGAAATGGTGGGG - Intronic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
905853532 1:41291545-41291567 GAGAAGATGGACCAGTGAGGAGG - Intergenic
905984848 1:42270597-42270619 AAGAAGTTGGTGAAGTGGAGAGG + Intronic
906187501 1:43872234-43872256 GAGGAGAGGGAGGAGAGGTGTGG + Intronic
906406169 1:45544050-45544072 GGGAAGAGGAGGAAGTGGTGTGG - Intergenic
906509163 1:46401077-46401099 GGGAAGAGGGGGAAGTGGGGAGG + Intronic
906613919 1:47222242-47222264 GAGATGGTGGGGAAGTGGTCAGG + Intronic
906815388 1:48873490-48873512 GAGAGGATGGAGGAGTGAGGAGG - Intronic
907300767 1:53485163-53485185 GAGAAGCTGCAGAAGGGGTGGGG + Intergenic
907618885 1:55955187-55955209 GTGAAGATGTAGAAGAGGTGAGG + Intergenic
907972013 1:59392366-59392388 CACAAGATACAGAAGTGGTGTGG + Intronic
908124739 1:61019310-61019332 GAGGAGCTGGAGAAATAGTGAGG + Intronic
908262447 1:62349514-62349536 GAGAGGAGGGGGAAGTGGGGAGG + Intergenic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
909751260 1:79164743-79164765 GGAAAGATGGAGAAGTGCAGAGG - Intergenic
909981475 1:82107011-82107033 GAAAAGATAGAGAAAAGGTGGGG + Intergenic
910495252 1:87819708-87819730 GAGAAGAGGGAGAAGTGAAGAGG + Intergenic
910520636 1:88118218-88118240 GACAGGAAGGAGAAATGGTGTGG - Intergenic
910674129 1:89800170-89800192 GAGAAGAAGGTGAACTGGAGAGG + Intronic
912007527 1:104922871-104922893 GAGAAAATGGAATAGGGGTGGGG - Intergenic
912522488 1:110255321-110255343 GAGAAGACGGTGAAGTGAAGAGG - Intronic
912680035 1:111723257-111723279 GAGGAGATGGGGATGTGGAGAGG + Exonic
912703426 1:111895122-111895144 GGGAGGAGGGAGAAGTGGGGAGG + Intronic
912753478 1:112304764-112304786 GTGATGGTGGAGGAGTGGTGGGG - Intergenic
912770294 1:112457256-112457278 TAGCAGATGGAGAAGGGGTGAGG - Exonic
913182567 1:116336460-116336482 GAAAAGAGGGAGCTGTGGTGAGG + Intergenic
913219283 1:116646326-116646348 AGGAAGATGGAGAATTGGGGGGG + Intronic
913538063 1:119793334-119793356 GAGTAGAAGGAGAACTGGTTAGG + Intergenic
914489737 1:148143790-148143812 GAGCAGATTGAAAGGTGGTGGGG + Intronic
915128190 1:153680016-153680038 GAGAGGATAGAGACGTGGTGGGG - Intronic
915135494 1:153728481-153728503 GAGAGGAGGGAGGAGTGGAGAGG + Exonic
915184721 1:154095395-154095417 TAGAGGATGCAGAAGTGGTGTGG - Intronic
915323517 1:155069094-155069116 GACAAGATGGAGCATTGATGGGG + Exonic
915526018 1:156476769-156476791 GAGGTGAGAGAGAAGTGGTGGGG - Intronic
915801929 1:158802597-158802619 GATAATATGGTGATGTGGTGAGG - Intergenic
915810295 1:158902040-158902062 TAGAAGATGGAGAAATGGCTAGG + Intergenic
915831339 1:159133751-159133773 GAGGAGTCGGAGAAGTAGTGGGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916871701 1:168921713-168921735 AGAAAAATGGAGAAGTGGTGAGG - Intergenic
916877010 1:168980092-168980114 GATAAGATAGAGAGGAGGTGGGG - Intergenic
917061759 1:171049034-171049056 GAGGAGAGGGAAAAGTGGGGAGG - Intronic
917070171 1:171141899-171141921 GAGAAGAAGGAGAGGTGGGAAGG - Intronic
917600942 1:176573057-176573079 GTGAGGGTGGAGAAGTGCTGAGG + Intronic
918101650 1:181381492-181381514 GAGAAGATGAGGAAGTGGGGAGG + Intergenic
918143231 1:181735087-181735109 GAGAAGATGCGGAAATGGAGAGG - Intronic
919325287 1:196099610-196099632 GAGAAGATGGAAAAGTGGGGGGG + Intergenic
919936108 1:202251847-202251869 GAGGAGATGGGAAAGTGGAGAGG + Intronic
920073463 1:203320315-203320337 GGGAGGATGGAGGGGTGGTGAGG - Intergenic
920442271 1:205989147-205989169 GAGAGGATGGAGGAGGGGTGAGG - Intronic
920823462 1:209402746-209402768 GAGAAGATGCAGGAATGGGGGGG + Intergenic
921803124 1:219424668-219424690 GATGAGATGGAGAAGCAGTGTGG - Intergenic
922518969 1:226229845-226229867 GAGCAGATAAAGAAGTGGGGGGG + Intergenic
922724402 1:227915711-227915733 GAGAAGCTGGAGAGGAGGAGGGG - Intergenic
922781600 1:228257026-228257048 GAGGGCATGGAGAAGTGGAGAGG - Intronic
922800617 1:228363120-228363142 GAGAAGAGGGAGAGGAGGAGAGG + Intronic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
923042380 1:230328329-230328351 GAGAGGATGCAGATCTGGTGTGG - Intronic
923908782 1:238415790-238415812 GAGAAGAGAGAGAAGAGGAGAGG + Intergenic
924327318 1:242908963-242908985 GAGAAGATGGAGAGGAGGAGGGG - Intergenic
924517808 1:244780822-244780844 AAGAAGGTAGAGAAGTGGAGTGG - Intergenic
924817276 1:247453652-247453674 GAGAAAAGGGAGAAGTTGTAGGG + Intergenic
1062778839 10:181666-181688 AAGGAGATAGAGAAGGGGTGAGG + Intronic
1062791849 10:311678-311700 GAGAAGAGGGAGGGGTGGGGAGG + Intronic
1063358542 10:5427416-5427438 GAGAAGGAGAAGAAGTGGGGAGG - Intronic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1066472636 10:35713993-35714015 GGGAATATGGAGACCTGGTGGGG + Intergenic
1067174807 10:43938093-43938115 GAGAAGGAGGAGGAGTGTTGAGG + Intergenic
1067211509 10:44263433-44263455 GAGAAAAGGCAGAAGTGATGGGG - Intergenic
1067285492 10:44904771-44904793 TGGAAGATAGAGAGGTGGTGCGG + Intergenic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1068652162 10:59534450-59534472 GTGTAGTTGGAGAGGTGGTGAGG + Intergenic
1069266050 10:66459038-66459060 GAGAAGATGAGGAAGTGGAAGGG - Intronic
1069782984 10:70968498-70968520 GAGTAACTGGAGAAGGGGTGAGG + Intergenic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070398130 10:76030853-76030875 GAGAAAAGAGAGAATTGGTGAGG - Intronic
1070537609 10:77391349-77391371 GACATGATGGAGACGGGGTGAGG - Intronic
1070670338 10:78373210-78373232 GAGAAAATGGAGAGGGGGTGAGG - Intergenic
1070720357 10:78752723-78752745 GAGAAGATGGAGCGGTGGGCTGG + Intergenic
1071102438 10:82054641-82054663 TAGAGGCTGGAGAAGTGGGGAGG + Intronic
1071506326 10:86233920-86233942 GAGAGGGTGGAGAGGGGGTGGGG + Intronic
1071561952 10:86651950-86651972 GAGGAGGAGGAGAAGTGCTGAGG + Intergenic
1072233988 10:93437795-93437817 CAGGAGAGGGAGAAGTGCTGGGG - Intronic
1072585460 10:96777726-96777748 GAGAAGGGTGAGAAGGGGTGAGG + Intergenic
1073113010 10:101073827-101073849 GAGGAGATGGAGATGGGGAGAGG + Intergenic
1074320501 10:112397708-112397730 GAGGAAATGGATTAGTGGTGGGG - Intronic
1074736949 10:116445445-116445467 GAGAAGATAGAGAAGTGTCGGGG - Intronic
1074920930 10:118010540-118010562 GAGAGGCTGGGGAAGTGGTGAGG - Intronic
1075688536 10:124380114-124380136 GAGGAGATGGGGAAGAGCTGGGG - Intergenic
1076667810 10:132102905-132102927 GAGGAGATGCAGGAGTGATGGGG + Intergenic
1077180301 11:1209269-1209291 GGGAAAAGGGAGAAGTGGAGGGG - Intergenic
1077323949 11:1955496-1955518 GAGAAGAGGGAGGAGGAGTGAGG - Intronic
1077528144 11:3081088-3081110 CAGGAGCTGGAGAGGTGGTGAGG + Intergenic
1078014985 11:7605336-7605358 GAGAAGAGGGAGACATGGTAGGG + Intronic
1078100699 11:8328816-8328838 GAGAGGATGGGGAGGGGGTGGGG - Intergenic
1078362771 11:10682069-10682091 GAGAAAATGGAGACTTTGTGAGG - Intronic
1078631230 11:13006577-13006599 GAGAAGCTGGAGAAGTGGGCTGG + Intergenic
1078659664 11:13277272-13277294 AAGAAGAAGGAGGAGGGGTGAGG + Intronic
1078720774 11:13881234-13881256 GAGAAGATGGGGAGGGGGAGGGG + Intergenic
1078804843 11:14688176-14688198 GAGAAGAGGGAGAGGGGGAGAGG - Intronic
1078928128 11:15892466-15892488 GAGAAGATGGAGGTGTCCTGGGG - Intergenic
1080169822 11:29287244-29287266 GGGGAGAGGGAGAAGTGGTTTGG + Intergenic
1080176003 11:29363916-29363938 GAGAAGAGGGAGTAGGGGTATGG + Intergenic
1080193462 11:29579384-29579406 GGGAAGATGGAGAATTGGAACGG - Intergenic
1080240334 11:30120277-30120299 GAGGAGAGGGAGTAGAGGTGTGG - Intergenic
1080903248 11:36515558-36515580 GAGAAGAGGGTGGAATGGTGGGG - Intronic
1081842628 11:46214199-46214221 GAGAAGACAGAGAAATGGAGGGG - Intergenic
1083170516 11:60921724-60921746 GCCAACCTGGAGAAGTGGTGAGG - Intronic
1083337548 11:61933341-61933363 CACAAGATGGAGGAGTGTTGTGG + Intergenic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1083644447 11:64164549-64164571 GAGCAGATGGAGAACTTGTCAGG - Intronic
1083743338 11:64722512-64722534 GAGAAGAGAGAGAAGTGGAGAGG - Intronic
1085173987 11:74470903-74470925 GGGAAGATGGGGGAGTGGGGTGG + Intergenic
1085390958 11:76181956-76181978 GAGAAGAAGGTGATGTGGAGGGG - Intergenic
1085810146 11:79672585-79672607 GAAAGGAAGGAGAATTGGTGAGG + Intergenic
1086864931 11:91969547-91969569 AAGAAGATTGAGCAGTGGTAGGG - Intergenic
1087065142 11:94021025-94021047 GAAAAGAAGAAGAAGGGGTGGGG + Intergenic
1087237223 11:95733477-95733499 GAGGAAATGGAGGAGGGGTGGGG - Intergenic
1087279543 11:96194838-96194860 GAGAAGCTGGAGAGGTTGAGGGG - Intronic
1087557466 11:99739592-99739614 GAGAAGATGGAAAGGTGGAGGGG + Intronic
1087644184 11:100787946-100787968 GACAAGATAGATAAGTGCTGAGG + Intronic
1087932258 11:103991327-103991349 AAGAAGATGGAGAAGGGAGGAGG - Intronic
1087948098 11:104189372-104189394 GAGATGGAGGAGACGTGGTGAGG + Intergenic
1088783701 11:113161812-113161834 GAGAAGGTGGAGAAGCACTGTGG + Intronic
1088960793 11:114662656-114662678 GAGGAGAGGGAAGAGTGGTGAGG + Intergenic
1089055912 11:115584666-115584688 GAGAAGAGGAAGAAGTAATGAGG + Intergenic
1089114488 11:116083226-116083248 GGGAAGATGTGGAAGTGGTGGGG - Intergenic
1089199476 11:116715158-116715180 GAGAAGACAGAGAAAGGGTGTGG + Intergenic
1089690562 11:120184486-120184508 AAGAGGCTGGAGCAGTGGTGAGG - Intronic
1089723392 11:120450960-120450982 GAGGAGATGGAGGAGGGGTGAGG - Intronic
1090067952 11:123519307-123519329 GAGAGGACAGGGAAGTGGTGGGG + Intergenic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1090526747 11:127545855-127545877 GAGAAGAAGGTAATGTGGTGTGG + Intergenic
1202806935 11_KI270721v1_random:10691-10713 GAGAAGAGGGAGGAGGAGTGAGG - Intergenic
1091376865 12:31019-31041 GGGAAGACGCAGAAGTGGGGAGG + Intergenic
1091967241 12:4754982-4755004 GAGGAGAGGGAGAAGTGAGGAGG - Intronic
1092524920 12:9303907-9303929 GAGAAGATAGGGAAGGGTTGGGG + Intergenic
1092542347 12:9427911-9427933 GAGAAGATAGGGAAGGGTTGGGG - Intergenic
1092985215 12:13838592-13838614 GATAAGATGGGGGGGTGGTGGGG - Intronic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1093011241 12:14109644-14109666 GTGAGGATGGAGAAGTGGCAGGG - Intergenic
1093124610 12:15313526-15313548 GAGAAGAGGGAAGAGTGGGGAGG - Intronic
1094442615 12:30495546-30495568 GAGCAGATGGTAAAGTGGGGCGG - Intergenic
1094510668 12:31094522-31094544 GAGAAGATAGGGAAGGGTTGGGG + Intronic
1095573274 12:43706165-43706187 GAGGAGAGGGAAAAGTGGGGAGG - Intergenic
1095866934 12:46982886-46982908 ATGAAGATGGAGATGTTGTGAGG + Intergenic
1095878427 12:47106698-47106720 GAAAAGATAGAGAAGCGGGGAGG - Intronic
1095904997 12:47368642-47368664 GAAAAGAAAGAGAAGTGGAGGGG + Intergenic
1096003706 12:48151109-48151131 GAAGAGATGGAGGAGTGATGGGG + Intronic
1096615209 12:52828803-52828825 CAGAAGATGGAGGGGTGGGGAGG - Intronic
1096737878 12:53670128-53670150 GAGAAGCAAGAGAAATGGTGTGG - Intronic
1096877018 12:54637293-54637315 TAGAAGATGGCAAAGTGATGAGG + Intergenic
1096970838 12:55665038-55665060 GAGAAGATGGGGAAGCACTGTGG - Intergenic
1097320484 12:58220460-58220482 GAGAGGAGGGCCAAGTGGTGAGG - Intergenic
1097369975 12:58766414-58766436 GAGAAGATGGGCAGGTGGGGAGG + Intronic
1097540738 12:60938962-60938984 GAATAGTTGAAGAAGTGGTGGGG - Intergenic
1097552372 12:61090704-61090726 GAGGAGATGGAAGAGTGGGGAGG - Intergenic
1097920149 12:65063326-65063348 GGGAGGATGGAGAAATGGAGAGG + Intronic
1098198423 12:68027421-68027443 GAGAAAATTGAGGGGTGGTGGGG + Intergenic
1098416452 12:70240622-70240644 GGGAAGATGGAGAAGTGGGCAGG + Intergenic
1098486852 12:71031497-71031519 GAGAAGATTGAGGAGGGGAGAGG + Intergenic
1098801070 12:74958908-74958930 TATAACATGGAGAAGTGGTTTGG - Intergenic
1099354558 12:81617932-81617954 GAGAAGAAGTAGAGGTGGTGTGG + Intronic
1099425272 12:82516040-82516062 GACCAGATAGGGAAGTGGTGGGG + Intergenic
1099629750 12:85127509-85127531 GAGAAGGGGAAAAAGTGGTGAGG - Intronic
1100113884 12:91279053-91279075 GAGAATATGTAGATGTAGTGGGG - Intergenic
1100669296 12:96793177-96793199 GAGAGGGTGGAGCAGGGGTGAGG - Intronic
1100722035 12:97369347-97369369 GAAAGGATGGAAAAGGGGTGAGG + Intergenic
1100862290 12:98818883-98818905 GATAAAATGAAGAAATGGTGGGG - Intronic
1101139355 12:101779137-101779159 ATGAAGATGGAGTAGTGGTGGGG - Intronic
1101671902 12:106883490-106883512 TAGGAGATGGAGATTTGGTGGGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102146113 12:110656234-110656256 GTGAAGATGGTGAAGGGGAGAGG + Intronic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1102904250 12:116662265-116662287 GAGAAGAGGGAGAGGTAGAGGGG - Intergenic
1103180549 12:118907521-118907543 GAGAAGAAGGAGAAGAGAAGAGG + Intergenic
1103225652 12:119285155-119285177 GAGCAGAGGGAGGAGAGGTGAGG - Intergenic
1104088121 12:125493966-125493988 GAGAAGAGGGAGGAGGGATGCGG - Intronic
1104707889 12:130961433-130961455 GAGAAAATGGAGGAGGGGTGGGG - Intronic
1105266714 13:18825327-18825349 GTGAAGATGGCTAAGTGATGTGG + Intergenic
1105414321 13:20195157-20195179 GAGGAGAAGGAGGAGAGGTGAGG + Intergenic
1105725620 13:23159988-23160010 GAGAAACTGGAAAAGTGGAGGGG + Intergenic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1107822643 13:44300292-44300314 GACATGTTGGTGAAGTGGTGAGG - Intergenic
1107983059 13:45751851-45751873 GAGGAGATGGAGAGGTGGTTAGG - Intergenic
1108019573 13:46113315-46113337 GAGAAGCCCGGGAAGTGGTGTGG + Intergenic
1108247567 13:48533003-48533025 AAGAGGGTGGAGGAGTGGTGTGG - Intronic
1108698615 13:52924988-52925010 GAGAAGATGGAGAGGAAATGTGG - Intergenic
1109480626 13:62947082-62947104 GAGAATATGAAAAAGTTGTGTGG - Intergenic
1109690233 13:65878519-65878541 AAGAAGAGGGAGAAGAGGTAGGG - Intergenic
1109692589 13:65912351-65912373 TAGAAGATGGAGAAATTTTGTGG - Intergenic
1110134915 13:72054785-72054807 TTGAAGATGGAGAATTGGAGAGG - Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111675605 13:91384738-91384760 GCGAAGAGAGAGAAGTGGTGGGG + Intergenic
1112295005 13:98178715-98178737 GGGATGAGGGAGAAGTTGTGTGG + Intronic
1112358691 13:98696716-98696738 GAGAGGTGGGAGAAGGGGTGAGG + Intronic
1112848326 13:103671912-103671934 GAAGAGATTGAGAAGTGGTCAGG - Intergenic
1113266075 13:108619732-108619754 GAGAAGGTGGAGAAGGGAAGGGG - Intronic
1113787721 13:113011406-113011428 CAGATGATGGACAGGTGGTGTGG + Intronic
1114042716 14:18693545-18693567 GAGAATCTGGAGAAGTGTGGAGG - Intergenic
1114195019 14:20469519-20469541 GAGACCATGGAGAACGGGTGAGG + Exonic
1116475862 14:45338591-45338613 GAGAAGAGGAAGAAGAGGAGAGG + Intergenic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1117785510 14:59280494-59280516 GAGAAGATGGGGAAGCTGGGAGG - Intronic
1117945834 14:61019428-61019450 AAGCAGATGCAGAAGTTGTGAGG - Intronic
1118255271 14:64200285-64200307 GGGAAGAGGGAGAAGTGGGGAGG + Intronic
1118907135 14:70031359-70031381 CAGGAGATGGAGGAGTGGAGAGG - Intronic
1120055045 14:79914225-79914247 GAGAAGAAGAAGACTTGGTGTGG + Intergenic
1120281437 14:82443615-82443637 GAGAAGATGGAGAAGGGGAAGGG - Intergenic
1121074976 14:91060418-91060440 GAGAAGATGGAGGAGGAGGGTGG - Exonic
1121132599 14:91462167-91462189 TAGAAGATGAAGAAGAGATGTGG - Exonic
1121188012 14:91994090-91994112 GACAAGATGGAGAAGTGTTTAGG - Intronic
1121321755 14:92995638-92995660 GAGAGGATGGCTAAGGGGTGAGG - Intronic
1121447509 14:93988156-93988178 GAGGAGTTGGAGGAGGGGTGGGG + Intergenic
1121905790 14:97741542-97741564 GAGAGGAAGGAGAAGCAGTGTGG - Intergenic
1122253859 14:100462799-100462821 GAGAGGATGGAGAGGAGGAGAGG - Intronic
1122786637 14:104167100-104167122 GAGAAGACGCAGGAGGGGTGAGG + Intronic
1124361057 15:29036646-29036668 GAGATGATGTAAAAGAGGTGTGG - Intronic
1124995043 15:34715484-34715506 GAGAAGGAAGAGAAGTGCTGAGG - Intergenic
1125044546 15:35230892-35230914 GAGGAGATGGAAAAGTGGGGAGG - Intronic
1125050949 15:35297601-35297623 GAAAAGATAGAGAAGTGAAGAGG - Intronic
1125457047 15:39870567-39870589 AACAAAATGGAGAATTGGTGTGG + Intronic
1125512256 15:40298387-40298409 CAGAGGATGGGGAAGAGGTGAGG + Intronic
1125645275 15:41267233-41267255 GTGAAGATGCAGAAGTTATGGGG + Intronic
1126216205 15:46157628-46157650 GAGAAGAGGGAAGAGTGGAGAGG + Intergenic
1126319594 15:47407889-47407911 GAAAGGAGGGAGAAGGGGTGAGG - Intronic
1126736380 15:51736075-51736097 GAGAAGATGGATGAGAGGTAAGG - Intronic
1127144323 15:56008962-56008984 GAGAGGCTGAAGAAGTGATGTGG + Intergenic
1127370238 15:58332286-58332308 GACAAGCTGAAGAAGTTGTGTGG + Intronic
1127541282 15:59941369-59941391 CAGAAGAGGGAGCAGTGGGGTGG - Intergenic
1127691109 15:61398640-61398662 GAAAAGAGGAAGAAGTGGGGAGG + Intergenic
1128756386 15:70186443-70186465 AAGCAGATGGAGAAGAGGAGTGG - Intergenic
1129065045 15:72895518-72895540 GAGAAGCCTGGGAAGTGGTGTGG - Intergenic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1129164188 15:73766974-73766996 GAGAAGATGTGACAGTGGTGAGG + Intergenic
1129184385 15:73897066-73897088 GGGATGATGGAGAAATGGAGAGG - Intergenic
1129236363 15:74225959-74225981 GGGAAGATGGAGAATGCGTGTGG + Intergenic
1129240657 15:74250169-74250191 GAGCAGTTGGAGAAATAGTGCGG - Intronic
1129259284 15:74355159-74355181 GAGAAGAGGGAGGAATGGAGGGG - Intronic
1129464257 15:75715140-75715162 GGGAAGATGGGGAGGGGGTGGGG - Intergenic
1129589020 15:76898737-76898759 GATAAGATGGGGAAGTAGGGAGG + Intronic
1129649966 15:77478166-77478188 GAGAATAGGGAGATGAGGTGGGG + Intronic
1129913544 15:79247762-79247784 AAGAAGATGGGGCAGGGGTGTGG + Intergenic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130209713 15:81911914-81911936 GATACTATGGAGAAGTGGTATGG + Intergenic
1130367661 15:83254678-83254700 GTGAATATGGAGAGTTGGTGGGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130770287 15:86917163-86917185 GAGAAGATGGGGGAGAGGCGTGG + Intronic
1131157571 15:90084572-90084594 GAGAAGCTGGGAAAGGGGTGTGG + Intronic
1131389101 15:92032747-92032769 GCCAAGTTGGAGATGTGGTGAGG + Intronic
1131407458 15:92176893-92176915 GAGCAGACTGAGAAGAGGTGTGG - Intergenic
1131791685 15:95972443-95972465 GTGAAGAAGGAGAAGTGAGGAGG + Intergenic
1131864426 15:96692167-96692189 GAATGGATGGAGAAGTGGGGAGG + Intergenic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1132210830 15:100020968-100020990 AAGGAGATAGAGAAGTGGAGGGG - Intronic
1132541998 16:514536-514558 GAGAAGATGGAGGAGTGGAGAGG + Intronic
1132770957 16:1563075-1563097 GGGAAGATGGAGACGTGGCAGGG - Intronic
1133392224 16:5419824-5419846 TTGAAGATGGAGAAGGAGTGTGG + Intergenic
1134624355 16:15713430-15713452 GAGAAGATGAGGGAGGGGTGTGG + Intronic
1134650482 16:15904611-15904633 GAGACCATGGAGGAGTGGAGTGG - Intergenic
1134743176 16:16566498-16566520 GAGGAGGAGGAGAAGTGGGGGGG - Intergenic
1134784709 16:16931106-16931128 GAGAAGAGAGAGCAGTGGAGAGG + Intergenic
1134858089 16:17537330-17537352 GAGAAGATAGCAGAGTGGTGGGG - Intergenic
1134924384 16:18145962-18145984 GAGGAGGAGGAGAAGTGGGGGGG + Intergenic
1135174297 16:20214567-20214589 GAGAAGAAGAGGAAGGGGTGGGG + Intergenic
1136395343 16:29989474-29989496 GAGAAGAGAGAGAAGAGGAGAGG - Intronic
1136499742 16:30664411-30664433 GAGAACAAGGAGGGGTGGTGGGG - Exonic
1136605506 16:31331006-31331028 GAGAGGAGGGAGAAGAGGTGGGG + Intronic
1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG + Intergenic
1137692355 16:50437797-50437819 GAGAAGAGGGAGTAGGGCTGGGG - Intergenic
1138065430 16:53936368-53936390 ATGGAGGTGGAGAAGTGGTGGGG - Intronic
1138267197 16:55668097-55668119 TAGAAGATGGATCAGTGGTGGGG - Intronic
1138284068 16:55794461-55794483 GGGAAGAGGGAGACGTGCTGAGG + Intergenic
1138284934 16:55802526-55802548 GGGAAGAGGGAGACGTGCTGAGG - Intergenic
1138609510 16:58111480-58111502 CAGGAGGTGGAGAAGTGGAGGGG - Intergenic
1139216046 16:65124238-65124260 GAGAGGATGGACAAGGGGTCCGG + Intronic
1139646946 16:68338380-68338402 GGGAAGGTTGGGAAGTGGTGAGG + Intronic
1139829162 16:69782527-69782549 GAGGAGATGGAGAATTGCTATGG + Intronic
1140296219 16:73712088-73712110 GAGATGAGGGAGGAATGGTGAGG + Intergenic
1141275546 16:82584648-82584670 GAGAAGAAGAAGAAGTAGGGAGG + Intergenic
1141669890 16:85486135-85486157 GAGAAGAGGAAGAGGAGGTGAGG - Intergenic
1141759451 16:86018222-86018244 GAGGAGAGGGAGAGGTGGCGGGG + Intergenic
1142885047 17:2907301-2907323 GAGAAGAAGGGGAAGGGATGCGG + Intronic
1143149122 17:4796436-4796458 CCGAAGATGGTGGAGTGGTGCGG + Intronic
1143355020 17:6321234-6321256 GAAATGATGGAGTAATGGTGGGG + Intergenic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1143891287 17:10104409-10104431 GAGTAGATAGAAAAGAGGTGGGG - Intronic
1144098613 17:11924057-11924079 GAGAAGATGAAGAAATGAAGGGG - Intronic
1144425305 17:15135667-15135689 AAGAAGATGAGGAAGAGGTGAGG + Intergenic
1144645924 17:16973323-16973345 GAGGACATGGAGAGGTGGAGAGG + Intergenic
1144762553 17:17715545-17715567 GAGAAGTGCGAGGAGTGGTGTGG + Intronic
1144832756 17:18140652-18140674 GAAAAGATGGAGAGGTGGGGTGG + Exonic
1145102730 17:20090173-20090195 AAGAAGACAGAGATGTGGTGTGG - Intronic
1145212688 17:21026609-21026631 GAGATGAGGGAGGAGCGGTGTGG - Intronic
1146804656 17:35855627-35855649 GAGAAGAGGAAGAAGTGGGCAGG + Intronic
1147359183 17:39920649-39920671 GAGAAACTGGAGAAGGGCTGGGG + Intergenic
1147909844 17:43848940-43848962 GGGAAGAGGGAGGGGTGGTGGGG + Intronic
1148520643 17:48271841-48271863 GACAAGAAGTAGAAGTGGTATGG - Intronic
1148676559 17:49448892-49448914 GAGAGAAGGGAGAAGGGGTGAGG + Intronic
1148745202 17:49914202-49914224 GAGCAGCTGGAGGAGGGGTGAGG - Intergenic
1149086296 17:52720809-52720831 GATAATCTGGAAAAGTGGTGGGG + Intergenic
1149466720 17:56885882-56885904 GATAAGTTGGACACGTGGTGGGG - Intergenic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151520966 17:74629301-74629323 GAGGAGAAGAAGAAGTGGTGGGG + Intergenic
1151568909 17:74916303-74916325 GAGAACAGGGAGAAGAGCTGTGG + Exonic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1151758166 17:76086503-76086525 GAGAAGGTGGAGAGGCTGTGGGG - Intronic
1151765333 17:76130798-76130820 AAGAGGATGGGGAGGTGGTGGGG - Intergenic
1153237759 18:3004912-3004934 GGGAAGATGGGGAGGTGATGTGG - Intronic
1153647075 18:7204975-7204997 GAGAAAAGGGAGAAGCGGGGTGG - Intergenic
1154421699 18:14236143-14236165 GTGAAGATGGCTAAGTGATGTGG - Intergenic
1155277587 18:24203627-24203649 GTGGAGATGGAGGAGTGGGGTGG - Intronic
1155628193 18:27860700-27860722 GAGAAGAAGAAGAAGTTGTCTGG - Intergenic
1155766174 18:29635750-29635772 GAGAAGATGGAGAAAAGGGAGGG + Intergenic
1156132088 18:33988477-33988499 AAGAAGATGCAGGAGAGGTGGGG + Intronic
1156585469 18:38426602-38426624 GAGAAAATAGAGCAGAGGTGTGG - Intergenic
1157297358 18:46456059-46456081 TGGAAGATGGAGAAGATGTGAGG + Exonic
1157357522 18:46949215-46949237 GAGAAGGAGGAGAAGTAGTTAGG - Intronic
1157368964 18:47092541-47092563 GAGAAAAAGGTGAAGTGATGGGG - Intronic
1157394909 18:47333479-47333501 GAGAGGATGCAGAAGTGGGCAGG - Intergenic
1157476279 18:48025512-48025534 GTGAAGATGGAGAAGGGGAAGGG - Intergenic
1157488628 18:48107223-48107245 GAGAAGGTGGAGGAGGGGTTAGG + Intronic
1157596786 18:48869061-48869083 GAGGAAAAGGAGAAGTGCTGAGG + Intergenic
1157873871 18:51253980-51254002 GAGAAGATTGGGAAGGGGTTGGG - Intergenic
1158578693 18:58662479-58662501 GAGACGATGAAGAAGTTCTGGGG - Intergenic
1158606829 18:58902967-58902989 GAGAAAGTGAAGAAGTTGTGAGG - Intronic
1159081507 18:63740675-63740697 GAGCACATGAAGAAGTGGTGAGG - Intergenic
1159097393 18:63919658-63919680 GAGAGGATGGAGTGATGGTGTGG + Intronic
1159130021 18:64270831-64270853 GTGATTATGGAGAAGTGGGGTGG + Intergenic
1159194223 18:65090892-65090914 GAGAAGAGAGAGAAGAGGTGGGG - Intergenic
1159306198 18:66646042-66646064 GAGAAAATGGAGAAATTGAGTGG + Intergenic
1159543856 18:69814943-69814965 GGTAAGATGGAGAGGTGGCGAGG + Intronic
1159786895 18:72725547-72725569 GAGATGGTGGAGAAGAGGTAGGG + Intergenic
1159853952 18:73561917-73561939 GAGAAGATGAAGAATTGTTCTGG - Intergenic
1160848986 19:1180657-1180679 TGGAGGAAGGAGAAGTGGTGAGG - Intronic
1161080256 19:2307010-2307032 GAGAGGATGCAGAAGGTGTGAGG - Intronic
1161195439 19:2983758-2983780 GAGAAGAAGGAGGAGGGATGAGG + Intronic
1161284574 19:3462784-3462806 GGGACGATGGAGAAGGGGCGAGG - Exonic
1161847265 19:6718964-6718986 GAGGAGATTCAGAAGGGGTGGGG + Intronic
1161957893 19:7506483-7506505 GAGAGGATGGAGAAGGGGCAGGG - Intronic
1162134323 19:8545803-8545825 GATGAGATGGAGAAGGGGAGAGG - Intronic
1162274134 19:9639675-9639697 GAGAAGAAGGTAAAGTGGAGCGG + Intronic
1162526670 19:11210357-11210379 GAGAAGATGAACAAGTGAGGAGG - Intronic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163572665 19:18091427-18091449 GAGGAGGTGGGGAAGTGCTGTGG - Intronic
1163666023 19:18604430-18604452 GAGAAAATTGAGAACTGGAGAGG - Intronic
1163701999 19:18790746-18790768 GAGAAGGTGGAGAGGAGATGGGG - Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164868729 19:31625950-31625972 GAAGAGATAGAGAAGTGGAGTGG - Intergenic
1165085675 19:33345080-33345102 GAGAAGGTGGAGAGGAGGGGAGG + Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165302073 19:34976647-34976669 GAGGAGCTGGAGAATTGGGGTGG - Intergenic
1166095178 19:40534027-40534049 GAGAAGATAGATAGATGGTGGGG - Intronic
1166147471 19:40847528-40847550 GTGAAGATGTTGAAGTGGAGGGG + Intronic
1166178563 19:41091232-41091254 GTGAAGATGTTGAAGTGGAGGGG - Intronic
1166253847 19:41588586-41588608 GAGAAGGTGGAGAGGTGTTCAGG - Intronic
1166997149 19:46725093-46725115 GAGGAGATGGAGGTGGGGTGGGG - Intronic
1167420298 19:49398843-49398865 GAGGAGAAGGAGACCTGGTGTGG - Intronic
1167576821 19:50321827-50321849 GAGAAGATGAGGCAGTGTTGGGG + Intronic
1168357739 19:55712903-55712925 GAGGAGATGGAGGAGGGGGGAGG + Intronic
925096528 2:1208606-1208628 GCCCAGATGGAAAAGTGGTGAGG - Intronic
926823754 2:16881917-16881939 AAGAGATTGGAGAAGTGGTGTGG + Intergenic
927487665 2:23499754-23499776 GAGATGAGGGAGGAGTGGGGCGG + Intronic
928926533 2:36585489-36585511 GAGAAGAGGGAGAGGTGGGTGGG + Intronic
929041810 2:37751596-37751618 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
930171745 2:48258505-48258527 GTGAAGATGCAGAAGTGGCCAGG - Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932054722 2:68432730-68432752 GAGAGGATGGAGAGATGATGGGG - Intergenic
933457980 2:82541282-82541304 GAGGAGGTGGAGAAGTGGAGAGG - Intergenic
933560991 2:83885902-83885924 GAGAAGGTGGAAAGGGGGTGAGG - Intergenic
933575569 2:84063413-84063435 GAGAAGAGGGGGTAGTGGTGAGG - Intergenic
934511174 2:94946027-94946049 AAGAAGGTGGGGAAATGGTGGGG - Intergenic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
936655532 2:114481933-114481955 GAGAAGAAGGAGAAGAGAGGAGG + Intronic
936713444 2:115160527-115160549 GAGAATATGGGGCAGTGGGGTGG - Intronic
938034641 2:128026868-128026890 GGGAAGATGGAGAAGGTGTAGGG - Intronic
938468849 2:131542303-131542325 GGGTAGATGGAGAAGTGGCAAGG - Intergenic
938487140 2:131723200-131723222 GAGGAGATGGGGAAGTGGACGGG + Intronic
938611187 2:132949117-132949139 AAGAAGCTGGTGAACTGGTGAGG + Intronic
938710099 2:133968759-133968781 AAGAAGAAGGAGAAGTTTTGAGG - Intergenic
939983750 2:148811078-148811100 GAGAGGAGGGAGAGGTGCTGGGG - Intergenic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941038203 2:160590533-160590555 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
941071134 2:160955883-160955905 GGGAAGATGGAGATGCAGTGTGG - Intergenic
941592639 2:167438801-167438823 GAGAAGTTTGAAATGTGGTGGGG - Intergenic
941694083 2:168532297-168532319 GAGAAAATAGAGAAGTTCTGTGG + Intronic
941745577 2:169083298-169083320 GAGAGGAAGGAAAAGAGGTGTGG - Intronic
942408947 2:175686176-175686198 GAGGAGATGGAGCAGTGGTGAGG - Intergenic
942487993 2:176459314-176459336 GAGAGGCAGGAGAAGTGTTGAGG + Intergenic
942493696 2:176516432-176516454 GAGGGGAAGGGGAAGTGGTGGGG + Intergenic
943141369 2:183986812-183986834 GAGATTTTGGAGAAATGGTGGGG - Intergenic
944333877 2:198505566-198505588 GGGAAGAGTGAGAAGGGGTGAGG + Intronic
944682365 2:202088723-202088745 TAGACGATTGAGAAGTGGTGGGG + Intronic
944954923 2:204798173-204798195 GGGATGAGGGAGTAGTGGTGTGG - Intronic
945432232 2:209777587-209777609 GAGTGGGTGGAGATGTGGTGAGG + Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
947044254 2:225961446-225961468 ACAAAGAGGGAGAAGTGGTGGGG + Intergenic
947893132 2:233643936-233643958 GAGGAGAGGGAAAAGTGGGGAGG - Intronic
948036206 2:234860098-234860120 GAGAAGGAGGAGATGTGGGGTGG + Intergenic
948388934 2:237598314-237598336 GGGAAAATGGAGAAGGGGAGAGG - Intronic
948684146 2:239659534-239659556 GGGACGAGGGACAAGTGGTGTGG - Intergenic
948863278 2:240763160-240763182 CAGGAGATGGAGCAGAGGTGAGG - Exonic
948906540 2:240982311-240982333 GAGAAGAGGGCGCAGGGGTGAGG + Intronic
948924577 2:241086988-241087010 GAGAAGTTTGAGGAGTGTTGGGG - Intronic
948939204 2:241187764-241187786 GAGGAGAGGGAGAAGTGGGGGGG + Intergenic
1168866342 20:1090112-1090134 GAGAAGAAGGAGGAAAGGTGAGG + Intergenic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1170786148 20:19469289-19469311 AAGGAGATGGAGAAATGGTTTGG + Intronic
1172234265 20:33359338-33359360 GAGAAAAGGGAGAAGTGGCTGGG - Intronic
1172280099 20:33701891-33701913 GAGAAGATTGAGAAGTCGGATGG + Intergenic
1172700569 20:36851412-36851434 ATGAAGATGGAGAAGTGGACGGG - Intronic
1172891296 20:38267545-38267567 GAGAAAATGGGGAAGGGCTGTGG + Intronic
1173004226 20:39127302-39127324 GAGGAGAGGGAAAAGTGGGGAGG - Intergenic
1173184128 20:40827365-40827387 GAGAAAATGAAGAAGTATTGAGG - Intergenic
1173607678 20:44343321-44343343 GAGAGGATGGAAAAGTGGCTCGG - Intronic
1174319456 20:49729585-49729607 AAGAAGATGGAGAAATGATTGGG - Intergenic
1174459722 20:50673727-50673749 GAGAGCATGGAGGCGTGGTGAGG - Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174767978 20:53271687-53271709 GATAAGAGGGAAAAGTGTTGCGG + Intronic
1175072383 20:56345345-56345367 GAGAACATGGAGAAGCTGAGTGG + Intergenic
1175342435 20:58242138-58242160 GACAAGAGGAAGAAGTGCTGTGG - Intergenic
1175985050 20:62760468-62760490 GAGGAGATGGGGGAGGGGTGGGG - Exonic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176851783 21:13923817-13923839 GTGAAGATGGCTAAGTGATGTGG + Intergenic
1177998642 21:28133370-28133392 GAGAATATGAGGGAGTGGTGGGG - Intergenic
1178691516 21:34754142-34754164 AAGAAGCTGGAGAGATGGTGGGG - Intergenic
1179051016 21:37888654-37888676 GTGAAGTTGGAGACCTGGTGGGG + Intronic
1179982006 21:44900544-44900566 GAGACGATGCAGAGCTGGTGGGG + Intronic
1180094735 21:45550786-45550808 GAGAAGGTGGAGGAGAGGAGAGG - Intergenic
1180820571 22:18824382-18824404 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1180853554 22:19033247-19033269 CACAAGATGGACAGGTGGTGAGG - Intergenic
1181206795 22:21258854-21258876 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1182548893 22:31090657-31090679 GAGGGGATGGAGAGGTGGGGTGG + Intronic
1183305133 22:37078854-37078876 GAGAAGAAGGAGAAGAGGAAGGG + Intronic
1183313544 22:37124754-37124776 GAGAAAAAGGAGGAGAGGTGGGG - Intergenic
1185077551 22:48691422-48691444 GGGAAGATGGAGACGTGGCCAGG + Intronic
1185236765 22:49718376-49718398 GAGAAGAAAGGGAAGTGGAGGGG - Intergenic
1203220129 22_KI270731v1_random:36569-36591 AGGAAGATGGAGAATTGGGGTGG - Intergenic
1203270697 22_KI270734v1_random:50257-50279 AGGAAGATGGAGAATTGGGGTGG + Intergenic
1203294027 22_KI270736v1_random:23116-23138 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
949500008 3:4670794-4670816 GAGAAGACGAGGAAGAGGTGTGG + Exonic
949731347 3:7117034-7117056 GAGTAGATTGGGAAGTGTTGGGG + Intronic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950905989 3:16538740-16538762 GAGATGAGGCAGAAGGGGTGAGG + Intergenic
950915598 3:16641873-16641895 GAGAAGAGGGAGAAGTGAAGGGG - Intronic
951252093 3:20405676-20405698 GAGCAGATGGAGAGGTCCTGTGG - Intergenic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
952705849 3:36377249-36377271 GATAATATGGAGAACTGTTGAGG - Intergenic
952770294 3:36993647-36993669 GAGATGATTGAGAACTGGTACGG + Exonic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953540452 3:43813331-43813353 GAGGAGATAGAGAAGAGGTGGGG - Intergenic
954070785 3:48141479-48141501 GAAGAGAGGGAGAAGTGGAGGGG + Intergenic
954269363 3:49495586-49495608 TAGGAGGTGGAGAGGTGGTGGGG - Intronic
954608014 3:51928877-51928899 GAGGAGGTGGAGAATTGGTGGGG - Intergenic
956481850 3:69681148-69681170 GAGAGGAGGGAAAGGTGGTGGGG - Intergenic
956715712 3:72078135-72078157 GAGAAAAGTGAGAAGCGGTGAGG + Intergenic
957735056 3:84192456-84192478 AAGAAAGTGGAGAAGGGGTGGGG + Intergenic
958460082 3:94383520-94383542 GAGAAGTTGGGGAAGGGCTGTGG - Intergenic
958891969 3:99794197-99794219 GAGAAGAGAGAGAAGGGGTATGG - Intronic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
960242911 3:115366444-115366466 GAAAACATGGACAAATGGTGGGG + Intergenic
960697215 3:120407912-120407934 GAGGAGATGGAGATGTGTTGAGG + Intronic
961359661 3:126358880-126358902 GGGCAGATGGAGAAGTGCTGTGG - Intergenic
962958332 3:140286785-140286807 TAGAAGAAGGAGGAGTAGTGGGG + Intronic
965026111 3:163303787-163303809 GAGGAGAGGGAAAAGTGGAGAGG + Intergenic
966074071 3:175915343-175915365 GAGAACATTGTGAAGTGGAGTGG + Intergenic
966318371 3:178674171-178674193 GAGAAGAGGTAGAAGAGATGAGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966979802 3:185121665-185121687 GTGAAGTTGGAGAAGTAGTAAGG + Intronic
967169747 3:186813814-186813836 GAGAAGAGGGTGAAATGATGGGG - Intergenic
967533934 3:190580640-190580662 GAGAAGGGGGAGAAATGGAGAGG + Intronic
968153894 3:196362307-196362329 AAGCAGATGGAGTAGTGGAGGGG - Exonic
968429220 4:545430-545452 GAGAAGAGGGAAGAGTGGGGAGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970536733 4:17037682-17037704 GAGATGAAGGAGGAGAGGTGGGG + Intergenic
970548558 4:17155527-17155549 GAGAAAATGGAGATGTGGCAGGG - Intergenic
970667518 4:18354452-18354474 GAGGAGAGGGAAAAGTGGGGAGG - Intergenic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971406100 4:26321526-26321548 GAGGAGATGGAGAGGGGATGCGG - Intronic
973234082 4:47878388-47878410 GAAAAGAAGGAGAAGGGATGAGG + Intronic
973639952 4:52892695-52892717 GAGAGGAGAGATAAGTGGTGTGG - Intronic
973645668 4:52949086-52949108 GAGAACATGGAGCACTGGTGAGG - Intronic
973899186 4:55450136-55450158 GAGAAGAGGCAGAAGGGGTTGGG + Exonic
974168743 4:58238912-58238934 GAAAATATGTAGAAGTGGAGAGG - Intergenic
974494591 4:62609963-62609985 GAGAAGAATGAGAAATGTTGAGG + Intergenic
975097826 4:70477623-70477645 GAGAAGAGGGAGAAGACATGAGG - Intronic
975330945 4:73112120-73112142 GAGAGGTTTAAGAAGTGGTGTGG + Intronic
975502306 4:75100345-75100367 GAGGAGAGGGGGAAGTGGGGAGG - Intergenic
975720752 4:77246555-77246577 CAGAAGTTCCAGAAGTGGTGGGG - Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976052956 4:81030541-81030563 GAGAAGAGGAAGTAGGGGTGGGG - Intergenic
976685838 4:87813759-87813781 GGGAAGAGTGAGAAGGGGTGAGG - Intergenic
977679631 4:99784915-99784937 GAGACGGTGGAGACGGGGTGGGG - Intergenic
977889456 4:102291465-102291487 CTGAAGATAGAGAACTGGTGTGG - Intronic
978118992 4:105055718-105055740 GAGAACATGGACACATGGTGGGG + Intergenic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
978499972 4:109399124-109399146 GAGAAAGTGGGGAGGTGGTGTGG + Intergenic
979437229 4:120707874-120707896 GAAAAGATGTAGAAATGGTCAGG + Intronic
980363312 4:131765274-131765296 AAGAAGAGTGAGAAGTGGGGAGG + Intergenic
980591729 4:134898333-134898355 GAGCAGATTGAGAAGTGCTTGGG + Intergenic
981310912 4:143297389-143297411 GTTAAGATGGAGAAATAGTGGGG - Intergenic
981364373 4:143884839-143884861 GAGAGGTTGAAGAGGTGGTGAGG + Intronic
981385488 4:144125330-144125352 GAGAGGCTGAAGAGGTGGTGAGG + Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981888073 4:149701964-149701986 GAGCATATGGACAAGTTGTGAGG - Intergenic
981980717 4:150787778-150787800 GGGAGGATGGAGGAGAGGTGGGG - Intronic
983686563 4:170416592-170416614 GAAAAGATGGAGATGTGGCCAGG - Intergenic
983981138 4:173998971-173998993 GTCAAGATGGAGAAGTGCTTTGG + Intergenic
984068554 4:175082128-175082150 GAGAAGAGGGAAGAGTGGGGAGG - Intergenic
984920618 4:184761165-184761187 TTGAAAATGGAGAACTGGTGTGG - Intronic
985860079 5:2464071-2464093 GTGAAGATGGAGCAGAGGTGAGG + Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986415301 5:7522280-7522302 GATAAGATGAATAAGTGCTGGGG - Intronic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
986701419 5:10412960-10412982 GATAAGGTGGGGAAGAGGTGAGG + Intronic
987224959 5:15830794-15830816 GAGAAGATGGTGGAGGGGAGTGG + Intronic
987682717 5:21158837-21158859 GTAAAGATGGAGTAGTGGAGAGG + Intergenic
988936371 5:36087001-36087023 GAAGAGACAGAGAAGTGGTGAGG + Intergenic
989205715 5:38807209-38807231 GAGAAGATGGAGAGGAGGGAAGG - Intergenic
989671763 5:43925377-43925399 GAGGAGAGGGAGAAGTGGTGAGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
991053463 5:62297038-62297060 GGGAAGATGGAGCAGTGGCATGG - Intergenic
991282275 5:64928677-64928699 GAGAAGAGGTAGAAGTGATAGGG + Intronic
992379567 5:76223910-76223932 GTGGGGATGGGGAAGTGGTGGGG + Intronic
992498692 5:77320401-77320423 GAGAAGATGCAGAACTGATCTGG - Intronic
992861845 5:80919186-80919208 GAGAAGAGTGAGAAGGGATGGGG + Intergenic
992941610 5:81767947-81767969 AACAAGATGGAGAAGAGTTGAGG - Intergenic
993900647 5:93582118-93582140 GAGAAGATGGAGAGGGGGGGAGG - Intergenic
994171015 5:96660191-96660213 GAACAGAAGGAGAAGGGGTGGGG - Intronic
994264580 5:97699927-97699949 GAGAAAATGTACAAGTGGGGAGG + Intergenic
994959337 5:106578720-106578742 AGGAAGATAGAGAAGAGGTGGGG + Intergenic
995177553 5:109196266-109196288 GAGATGATGGAGTAGGAGTGGGG + Exonic
995311846 5:110722083-110722105 CAGAAGATAGAGATGTGGTAGGG + Intronic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
996410830 5:123156862-123156884 GAGAAGAAGGCTTAGTGGTGGGG - Intronic
996930461 5:128880186-128880208 GACAAGAAGGAGTAATGGTGGGG + Intronic
997208983 5:132066686-132066708 GAGAGGAGGCAGAGGTGGTGTGG + Intergenic
997281547 5:132651144-132651166 GAGAAGCTGGGTAAGTGGAGGGG + Intergenic
998264648 5:140658862-140658884 GAGAATCTGGAGAAATGGTCAGG + Intronic
998355337 5:141530630-141530652 GAACAAATGGGGAAGTGGTGGGG - Intronic
998642464 5:144026855-144026877 GAGCACATGGAGAAGTGCTGGGG + Intergenic
999261496 5:150241466-150241488 GAGAAGAAGGAGGAGAGGGGAGG - Intronic
1000484351 5:161821543-161821565 CAGAAAATGGAGAGCTGGTGGGG - Intergenic
1000496690 5:161992952-161992974 GACAAAATGGAGATGTTGTGGGG + Intergenic
1000670098 5:164050866-164050888 GAGAAAATGGACAAATTGTGAGG + Intergenic
1000866890 5:166524877-166524899 TAGGAGATGGAGGAGTGGAGGGG + Intergenic
1001004476 5:168038352-168038374 GAGAAGGTGCAAAAGTGGTGAGG - Intronic
1001132877 5:169079462-169079484 TGGAAGATGGAGAAAGGGTGGGG + Intronic
1001217806 5:169872131-169872153 GAGATGAAGAAGAAGTGGAGGGG - Intronic
1002806085 6:575452-575474 GAGAGGATGGAGAGGGAGTGAGG - Intronic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1004202159 6:13558820-13558842 AAGCAGTGGGAGAAGTGGTGTGG + Intergenic
1004570268 6:16838221-16838243 GAGATAATGGAGAAAGGGTGGGG - Intergenic
1005913095 6:30327394-30327416 AAGAAGATGGAGAACGGGGGTGG + Intronic
1006131021 6:31869667-31869689 GAGAAGATGGACAGCTGGGGCGG - Intronic
1006173729 6:32109632-32109654 CAGCAGGTGGAGAAATGGTGGGG - Intronic
1006174306 6:32112711-32112733 AAGAGGATGGAGAACTGGTGTGG + Intronic
1006296274 6:33171461-33171483 GAGAGGATGGAGACAAGGTGAGG - Exonic
1007191228 6:40020642-40020664 GAGAAGATGGAAAAATGTTAGGG - Intergenic
1007303530 6:40886878-40886900 GAGGAGAGGGAGAAGAGGAGAGG + Intergenic
1007626101 6:43247213-43247235 GAGAAGATGGAGTGCGGGTGCGG - Intronic
1007841586 6:44720467-44720489 GGGTAGATGGAGCAGAGGTGAGG + Intergenic
1008215003 6:48777916-48777938 GAGAAGAGGGAAAAATGGGGAGG + Intergenic
1009219846 6:60970394-60970416 GAGGAAATGGAGATGTGGAGAGG - Intergenic
1009940634 6:70283660-70283682 GGCAAGATGGGAAAGTGGTGAGG + Intronic
1010043272 6:71412212-71412234 GTGAAGTTGGAGAGGAGGTGTGG + Intergenic
1010345586 6:74806420-74806442 GAGATGATGTAGAAGTAGTCAGG - Intergenic
1010473709 6:76261629-76261651 GAGAAGAGTGAGGAGTGGAGGGG - Intergenic
1011002033 6:82601192-82601214 GAGCAGATGGAGATTTGGTGTGG - Intergenic
1011180966 6:84620198-84620220 CAGAAGCTGGAGAAGTGATGGGG - Intergenic
1011743005 6:90382000-90382022 GAGAAAATAGAGAAGGTGTGAGG + Intergenic
1011803584 6:91046229-91046251 GAGAGGAAGGAGCAGTGGAGAGG - Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1013286636 6:108687539-108687561 GAGTAGAAGTAGAAGTGATGAGG + Intergenic
1013599386 6:111690250-111690272 GGGAAGAAGGTGCAGTGGTGGGG + Intronic
1013997244 6:116322817-116322839 GAGAAGAGAGAGAAGTGGCAGGG + Intronic
1015150040 6:130026935-130026957 GAGAAAATGGAGGGGTGGTGTGG + Intronic
1015508996 6:134018889-134018911 GAGAAGATAGAGAAGTGGTAGGG - Intronic
1016437301 6:144049964-144049986 TCGAAGCTGGAGAAGTGGAGGGG + Intronic
1017497577 6:154995386-154995408 GAGGAGTTGGAGAAGTTCTGGGG - Intronic
1017604452 6:156118947-156118969 GGGAAGATGAAGAAGTTCTGGGG + Intergenic
1017661914 6:156683338-156683360 GAGAAGAGGGATAAGTGGCTTGG - Intergenic
1017881707 6:158566682-158566704 GAGATGATGGTGAAGAGTTGAGG + Intronic
1018315482 6:162552770-162552792 GAGAAGATAGAGAGGACGTGGGG + Intronic
1018316518 6:162562054-162562076 GAGGAGATGGAGGAGTAGGGAGG + Intronic
1018454416 6:163939507-163939529 GCAAATATAGAGAAGTGGTGTGG + Intergenic
1019378873 7:711321-711343 GAGAAGCTGGAGAAGGTGAGTGG - Exonic
1019526368 7:1482227-1482249 GAGGAGGAGGAGAAGTGGTGGGG - Intronic
1019535276 7:1526114-1526136 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535300 7:1526201-1526223 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019535324 7:1526287-1526309 GAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019742730 7:2682768-2682790 GAAAAGCTGGAGAAGAGATGAGG - Intronic
1019776148 7:2913117-2913139 GAGAAGAGGGAGAAGGGAGGAGG + Intronic
1020209653 7:6149098-6149120 GAGAATGTGGAGACGTTGTGGGG + Intronic
1021406526 7:20274102-20274124 GAGAGGCGGGAGAAGTGGGGAGG + Intergenic
1021762833 7:23918026-23918048 GGAAAATTGGAGAAGTGGTGTGG + Intergenic
1021825555 7:24547282-24547304 AAGAAGCTGGAGATGTTGTGTGG + Intergenic
1022354877 7:29604479-29604501 GAGTAGATGGAGAACAGGAGTGG + Intergenic
1022502745 7:30892856-30892878 GAGAACATGCAGAAGTGCGGTGG + Intergenic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1023059179 7:36312560-36312582 CAGCAGATGGAAAAGAGGTGGGG + Intergenic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023372951 7:39530173-39530195 GAAAGGAAGGAGAAGAGGTGGGG + Intergenic
1023607665 7:41944685-41944707 AGGAATGTGGAGAAGTGGTGAGG + Intergenic
1023640795 7:42254997-42255019 GAGCAGATGGAAAAGTGGAAGGG - Intergenic
1023654496 7:42406401-42406423 CAGAAGATGGAGAAATGCAGAGG - Intergenic
1024403792 7:48954055-48954077 TAGAATATGGAAGAGTGGTGTGG + Intergenic
1024678619 7:51660748-51660770 GTGAAGATGAAGCAGAGGTGAGG - Intergenic
1024891631 7:54210634-54210656 GAGAAGAGGGAAAAGTGGAGAGG + Intergenic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1025198901 7:56950043-56950065 GGGAAGATGGAGGAGAGGGGAGG - Intergenic
1025673045 7:63626890-63626912 GGGAAGATGGAGGAGAGGGGAGG + Intergenic
1027398012 7:77776414-77776436 TGGAAGATGGAGAATTGGGGAGG - Intronic
1027433460 7:78138352-78138374 GAGAAGAAAGAGAAGAGGAGAGG + Intronic
1027729084 7:81846681-81846703 GAGAAGCTGCAGAACTGTTGGGG - Intergenic
1028447634 7:90943247-90943269 GTAGAGATGGAGAAGAGGTGGGG + Intronic
1028637197 7:93002796-93002818 GGGAGGATGGAGAAATAGTGAGG + Intergenic
1029529221 7:101114384-101114406 GAGAAGGGGGAGATGCGGTGGGG + Intergenic
1029991039 7:104962735-104962757 GATAAGACAGAGAGGTGGTGGGG - Intergenic
1030106147 7:105989220-105989242 CAGAAAGTGGAGAAGAGGTGGGG - Intronic
1031214842 7:118877207-118877229 GGGAAGAAGGAGAAGGGGAGGGG + Intergenic
1031340265 7:120591732-120591754 GAGAAGATTGAGGAATGGGGAGG - Intronic
1031950751 7:127889653-127889675 GAGAAGGTGGAGGAGAGGTAGGG - Intronic
1031988694 7:128181270-128181292 GAGCAGGTGGAGCAGAGGTGTGG + Intergenic
1032520297 7:132538739-132538761 GAGATAATGGACAAGGGGTGCGG - Intronic
1032879519 7:136074369-136074391 GACTGGATGGAGAAGTGGTAAGG + Intergenic
1032896042 7:136251872-136251894 GGGAACATTGAGCAGTGGTGTGG + Intergenic
1032946675 7:136861772-136861794 AAGAAGATGGACAAATGGTAAGG - Intergenic
1032955140 7:136961862-136961884 GAGGAGAAGGAGACGTGGGGAGG + Intronic
1033133344 7:138764229-138764251 AAGGAGATGGAGGAGGGGTGAGG + Intronic
1033832636 7:145271798-145271820 GAGAAGGAGGAGAAGAGGAGGGG + Intergenic
1034440887 7:151085684-151085706 GACAGGATGGACAAGGGGTGAGG + Intergenic
1034459906 7:151192463-151192485 GGGAGGAGGGAGGAGTGGTGGGG + Intronic
1034873686 7:154706170-154706192 GATAAGCTGGAGAAGTGGCAGGG - Intronic
1035029211 7:155846431-155846453 AAGAGGTTGGAGAAGTGCTGGGG + Intergenic
1035076005 7:156177994-156178016 GGGAAGAGGGAGAAGTGGGTAGG + Intergenic
1035351524 7:158250458-158250480 GAGCAGATGGAGAGGGGATGAGG - Intronic
1035625746 8:1069241-1069263 GGGAAGTGGGAGAGGTGGTGGGG + Intergenic
1035732185 8:1860871-1860893 CAGAGGATGGAGGGGTGGTGGGG + Intronic
1036182662 8:6598439-6598461 GAGAAGAAGGGGATGGGGTGGGG + Intronic
1036288349 8:7464085-7464107 GTGAGGAAGGAGAAGTGGAGGGG - Intergenic
1036333126 8:7847443-7847465 GTGAGGAAGGAGAAGTGGAGGGG + Intergenic
1037151917 8:15647029-15647051 GAGAAGAAGAAGAGGTGATGGGG - Intronic
1037300282 8:17444126-17444148 GAGGAGAAGGAGGAGTGGAGGGG - Intergenic
1037524186 8:19708688-19708710 GAGAGGATGGAGCAGTAATGAGG - Intronic
1037724163 8:21469268-21469290 GAAGAGAGGGAGAAGTGGGGAGG + Intergenic
1038206641 8:25473011-25473033 CAGAGGCTGTAGAAGTGGTGAGG - Intronic
1038268931 8:26059710-26059732 GAGAAGAAAGAGAAGTGATGGGG + Intergenic
1038395593 8:27243495-27243517 GACAAGTTGAACAAGTGGTGGGG - Intronic
1039129731 8:34249408-34249430 GAGAAACTGGAGATGGGGTGGGG + Intergenic
1039893350 8:41699134-41699156 GATAAGAGGGAGAGGGGGTGTGG + Intronic
1040287491 8:46107929-46107951 GAGAAAATGGAGCAGCAGTGTGG - Intergenic
1040860287 8:51991667-51991689 GGGAAGTTGAAGATGTGGTGAGG + Intergenic
1040975938 8:53194723-53194745 GAGAATATGGAAAATAGGTGTGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041566691 8:59286633-59286655 GAGAAGAAGTAGAACTGGAGGGG - Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1041860266 8:62504820-62504842 GAGCAGAAAGAGAAGTAGTGAGG - Intronic
1042017189 8:64327263-64327285 GAGAAGAGGGAGATGCTGTGGGG + Intergenic
1042964817 8:74339211-74339233 GAAAAGATGGATAAAGGGTGGGG - Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044297817 8:90548704-90548726 GAGAGGATGGAGGAGAGGTGGGG + Intergenic
1044466598 8:92513851-92513873 GAAAAGATGGAGAAAGTGTGTGG - Intergenic
1045527682 8:102955387-102955409 CAAAAGATGGAGAAGTGGCTGGG - Intronic
1045899513 8:107260540-107260562 GAGAATAAGTAGTAGTGGTGGGG + Intronic
1046312906 8:112462765-112462787 GAGGGGAAGGAGGAGTGGTGGGG - Intronic
1046326966 8:112661767-112661789 TAGAAGGTGGGGAAGGGGTGAGG + Intronic
1046584049 8:116129678-116129700 GAGAAGAGGGAGAAGGGGCTGGG + Intergenic
1046631006 8:116623214-116623236 GAGAAGATAGAGAAAGGTTGAGG - Intergenic
1047003346 8:120594862-120594884 GGGAAGATGAAAAAGTGCTGTGG + Intronic
1047632112 8:126719412-126719434 TAGTAGATTGAGAAGTGGTATGG - Intergenic
1047884902 8:129238975-129238997 GAGAATATGGGGAAATGCTGTGG + Intergenic
1048919828 8:139218153-139218175 ATGAAGCTGGAGAAGTGGTTTGG - Intergenic
1048919939 8:139219052-139219074 ATGAAGCTGGAGAAGTGGTTTGG - Intergenic
1049029796 8:140025946-140025968 GGGAAGATGGAGTAGTTCTGGGG - Intronic
1049272883 8:141705428-141705450 GAGATGATGGAGAGGTGATGGGG + Intergenic
1049293565 8:141817501-141817523 GAGATGAAGGAGAAAGGGTGGGG - Intergenic
1049433921 8:142577565-142577587 TGGAAGGTGCAGAAGTGGTGAGG - Intergenic
1049848462 8:144817492-144817514 GAAAAGATGGAGTAGTGGAGAGG - Intergenic
1049989148 9:976287-976309 GAGAAGAGAGAGAAGCGGAGCGG + Intergenic
1050395999 9:5196513-5196535 GAGGAGGTGGAGAAGTAGGGAGG - Intergenic
1050475910 9:6040922-6040944 GAGAAGATGAAGAAGTAAGGAGG - Intergenic
1050754114 9:8978645-8978667 GCCAAGGTGGAGAAGTGGGGTGG - Intronic
1050942181 9:11473235-11473257 AAGATGAAGGAGAAGTGGAGAGG + Intergenic
1051050313 9:12924682-12924704 GAGCAAATGGAGGAGTGGGGTGG - Intergenic
1051055298 9:12978175-12978197 GAGAAGAGGGAGATGAGGTCAGG - Intergenic
1051220463 9:14843301-14843323 GAGAAGATGGGCAAGGGGAGTGG - Intronic
1051237534 9:15017562-15017584 GAGAGGAGGGAGGTGTGGTGGGG - Intergenic
1051700916 9:19822996-19823018 GGGAAGATGGAGGAGTGGGAAGG - Intergenic
1051745532 9:20291613-20291635 GAGCAAATGCACAAGTGGTGGGG - Intergenic
1052050415 9:23841220-23841242 GAGAAGATGATGAGGAGGTGAGG + Intergenic
1052127581 9:24796849-24796871 AAGAAGAGGGAGAAGATGTGGGG + Intergenic
1052258835 9:26491372-26491394 GAGGAGAGGGAAAAGTGGGGAGG - Intergenic
1052298388 9:26924981-26925003 GAGAAGTGGGAGAATTGGTTGGG - Intronic
1052864768 9:33458238-33458260 GGGAAGAAGGAGAAGGGGTTAGG + Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1053654209 9:40198276-40198298 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1053904595 9:42827451-42827473 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1054530388 9:66178063-66178085 AAGAAGGTGGGGAAATGGTGGGG - Intergenic
1055164704 9:73176794-73176816 AAGAAGATGGAGAGCTGGGGGGG - Intergenic
1055839701 9:80488393-80488415 GAAAAGAGGGAGAAGTGATTTGG + Intergenic
1056328346 9:85500960-85500982 GAGAAGAGGGAATAGTGGGGTGG - Intergenic
1056368410 9:85929503-85929525 AAGAAGGTTGGGAAGTGGTGGGG - Intergenic
1057379746 9:94556481-94556503 AAGAAGGTGGGGAAATGGTGGGG + Intergenic
1057587688 9:96344423-96344445 TTGAAAATGGTGAAGTGGTGTGG - Intronic
1058418098 9:104808861-104808883 GTGAAGATGGTGGAGAGGTGAGG - Intronic
1058447512 9:105066871-105066893 TAGAAGATGGAGAAGCCGTGTGG + Intergenic
1058764282 9:108166203-108166225 GTGATGATGGAGAAGTGTAGCGG + Intergenic
1059756718 9:117300734-117300756 CAGAAGGTGGAGAAGTGGCAGGG + Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060492822 9:124097442-124097464 CAGAAGGTGGAGGAGAGGTGGGG + Intergenic
1060919301 9:127409085-127409107 GAGACGATGGGGAGGTGGGGGGG + Intergenic
1060919311 9:127409107-127409129 GAGACGATGGGGAGGTGGGGGGG + Intergenic
1060998974 9:127891714-127891736 GAGGAGAGGGAGAAGGGGAGGGG + Intronic
1061959561 9:133981103-133981125 GAGAAGCAGGAGACGGGGTGAGG + Intronic
1062362629 9:136194815-136194837 GGGAAGATGGAGAAGGGGAGGGG - Intergenic
1185468722 X:370209-370231 GCAAAGAGGGAGAACTGGTGTGG + Intronic
1186363836 X:8871194-8871216 GAGAGGATGGAGAAGGGTGGAGG + Intergenic
1187126090 X:16455834-16455856 GAGATGATGGGAAAGTTGTGGGG - Intergenic
1187354401 X:18553256-18553278 GGGAAGATGCAGAAATGGTTAGG + Intronic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1187861875 X:23690746-23690768 GAGACAATGGGGATGTGGTGGGG - Intergenic
1188212179 X:27439916-27439938 GAGAAGAGGGAGACATGGAGTGG - Intergenic
1189085003 X:38013759-38013781 GAGATGCTGGAGATGGGGTGAGG - Intronic
1189110620 X:38286155-38286177 GGGAGGATGGAGAAGGGGAGGGG - Exonic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189270202 X:39746280-39746302 CAGAAGGGGGAGACGTGGTGAGG - Intergenic
1189411622 X:40777945-40777967 GAAGAGAGGGAGAAATGGTGGGG - Intergenic
1189706116 X:43760486-43760508 GAGAAGATGGACGAGTTGTGGGG + Intergenic
1190035323 X:47018203-47018225 GGGAAGAAGGAGATGGGGTGAGG - Intronic
1190075024 X:47310716-47310738 CACAAGATGGAGGAGGGGTGTGG - Intergenic
1190907949 X:54746766-54746788 GAGAAGAGGGAAGAGTGGGGAGG - Intergenic
1192812505 X:74559716-74559738 GAGGAGAGGGAAAAGAGGTGAGG + Intergenic
1193694976 X:84697342-84697364 GAAAGGATGGGAAAGTGGTGAGG - Intergenic
1194065888 X:89261365-89261387 GAGAATTTGCAGAAATGGTGTGG - Intergenic
1194361073 X:92950890-92950912 GAGGAGAGGGAAGAGTGGTGAGG - Intergenic
1194389209 X:93295024-93295046 GAGGAGAGGGAAAAGTGGAGTGG + Intergenic
1194561514 X:95427707-95427729 GAGAAGAAGGAAGAGTGGGGAGG + Intergenic
1194754205 X:97718187-97718209 AAGGAGGTGGAGAGGTGGTGGGG - Intergenic
1194787668 X:98106559-98106581 GAGAAGATGGAATGGTGGGGAGG - Intergenic
1194939324 X:99990287-99990309 GAGAAGAAGGAATAATGGTGGGG + Intergenic
1195122998 X:101775457-101775479 GAGGAGAAGGAAGAGTGGTGAGG - Intergenic
1195470071 X:105220474-105220496 GAGAAGATGGATGAGGGGAGGGG - Intronic
1196227832 X:113187844-113187866 AAGAAGGAGGAGAAGTGATGTGG + Intergenic
1196508517 X:116477397-116477419 GAGAAACTGCAGAAGTTGTGAGG - Intergenic
1196535477 X:116838587-116838609 GAGAAGATGGCAAAGTGGGGAGG - Intergenic
1196625246 X:117870741-117870763 GAGGAGAGGGAGGAGTGGAGAGG + Intergenic
1196883235 X:120219576-120219598 CAGAAGATGGGGGAGTGCTGAGG - Intergenic
1197035128 X:121864264-121864286 GAGCAGCTGGAGCAGTGCTGAGG + Intergenic
1197410987 X:126116159-126116181 GAGAAGAGTGAGAAGTGAAGTGG - Intergenic
1198023472 X:132681920-132681942 GAGCAGATGGAGGAGTGGAGAGG + Intronic
1198242067 X:134796720-134796742 GAGAGGAGGGAGAAGAGGAGGGG + Intronic
1198467552 X:136917123-136917145 GAGGAGAAGGAGAAGAGGAGGGG - Intergenic
1198668313 X:139049433-139049455 GAGAAGTTGGAGAGTTGGAGGGG - Intronic
1198995277 X:142567123-142567145 GAGAAGAGGGAAAAGTGGGGAGG - Intergenic
1199263393 X:145801729-145801751 AGGCAGATAGAGAAGTGGTGGGG - Intergenic
1199308730 X:146297879-146297901 GAGAAGAAGGAAGAGTGGGGAGG - Intergenic
1199715470 X:150504716-150504738 GAGAAGAGAGAGAATAGGTGAGG - Intronic
1199721042 X:150542948-150542970 GAGCAGATGGGGAAGTGAGGAGG + Intergenic
1199765402 X:150937593-150937615 AAGCAGAAGGAGAAGTGATGTGG - Intergenic
1200137900 X:153883759-153883781 GAGAACCTGGGGTAGTGGTGGGG - Intronic
1200162925 X:154018530-154018552 GAAAGGCTGGAGAAGTGGTGAGG + Intronic
1200669267 Y:6066699-6066721 GAGGAGAGGGAAGAGTGGTGAGG - Intergenic
1201224733 Y:11807871-11807893 GAGAAGATGGAGAGGAGGAGGGG - Intergenic