ID: 1129148359

View in Genome Browser
Species Human (GRCh38)
Location 15:73670450-73670472
Sequence AAGATAGCTGACACTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129148359_1129148365 12 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148365 15:73670485-73670507 ATACTCCGTGGGAAGGAGTGAGG No data
1129148359_1129148369 24 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148369 15:73670497-73670519 AAGGAGTGAGGTTAAAGACGGGG No data
1129148359_1129148367 22 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148367 15:73670495-73670517 GGAAGGAGTGAGGTTAAAGACGG No data
1129148359_1129148364 5 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148364 15:73670478-73670500 ATAATGTATACTCCGTGGGAAGG No data
1129148359_1129148362 0 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148362 15:73670473-73670495 GGTGAATAATGTATACTCCGTGG No data
1129148359_1129148368 23 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148368 15:73670496-73670518 GAAGGAGTGAGGTTAAAGACGGG No data
1129148359_1129148363 1 Left 1129148359 15:73670450-73670472 CCCTTAAAAGTGTCAGCTATCTT No data
Right 1129148363 15:73670474-73670496 GTGAATAATGTATACTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129148359 Original CRISPR AAGATAGCTGACACTTTTAA GGG (reversed) Intergenic
No off target data available for this crispr