ID: 1129148549

View in Genome Browser
Species Human (GRCh38)
Location 15:73671779-73671801
Sequence CACAGCACGGGGAGGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129148549_1129148557 -8 Left 1129148549 15:73671779-73671801 CCTTTCACCCTCCCCGTGCTGTG No data
Right 1129148557 15:73671794-73671816 GTGCTGTGGCTCCAAGGATCAGG No data
1129148549_1129148559 8 Left 1129148549 15:73671779-73671801 CCTTTCACCCTCCCCGTGCTGTG No data
Right 1129148559 15:73671810-73671832 GATCAGGCCCAACTGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129148549 Original CRISPR CACAGCACGGGGAGGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr