ID: 1129148706

View in Genome Browser
Species Human (GRCh38)
Location 15:73673115-73673137
Sequence GACACAGGACAACTCGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129148703_1129148706 -9 Left 1129148703 15:73673101-73673123 CCAGATCTGTCCCTGACACAGGA No data
Right 1129148706 15:73673115-73673137 GACACAGGACAACTCGAAAGAGG No data
1129148699_1129148706 29 Left 1129148699 15:73673063-73673085 CCACATCCAATGACTGATCTGTG No data
Right 1129148706 15:73673115-73673137 GACACAGGACAACTCGAAAGAGG No data
1129148700_1129148706 23 Left 1129148700 15:73673069-73673091 CCAATGACTGATCTGTGCTTGAG No data
Right 1129148706 15:73673115-73673137 GACACAGGACAACTCGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129148706 Original CRISPR GACACAGGACAACTCGAAAG AGG Intergenic
No off target data available for this crispr