ID: 1129152807

View in Genome Browser
Species Human (GRCh38)
Location 15:73699660-73699682
Sequence CCACATGCACACCCATGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 268}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129152807_1129152813 0 Left 1129152807 15:73699660-73699682 CCCTGGCATGGGTGTGCATGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
Right 1129152813 15:73699683-73699705 GTGCAGCCCTGGGAGCACTGTGG 0: 1
1: 1
2: 3
3: 31
4: 373
1129152807_1129152816 14 Left 1129152807 15:73699660-73699682 CCCTGGCATGGGTGTGCATGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
Right 1129152816 15:73699697-73699719 GCACTGTGGTTCTGCCTCACAGG 0: 1
1: 0
2: 1
3: 19
4: 191
1129152807_1129152818 20 Left 1129152807 15:73699660-73699682 CCCTGGCATGGGTGTGCATGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
Right 1129152818 15:73699703-73699725 TGGTTCTGCCTCACAGGTGAGGG 0: 1
1: 1
2: 1
3: 11
4: 151
1129152807_1129152812 -10 Left 1129152807 15:73699660-73699682 CCCTGGCATGGGTGTGCATGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
Right 1129152812 15:73699673-73699695 GTGCATGTGGGTGCAGCCCTGGG 0: 1
1: 0
2: 3
3: 27
4: 239
1129152807_1129152817 19 Left 1129152807 15:73699660-73699682 CCCTGGCATGGGTGTGCATGTGG 0: 1
1: 0
2: 2
3: 16
4: 268
Right 1129152817 15:73699702-73699724 GTGGTTCTGCCTCACAGGTGAGG 0: 1
1: 0
2: 1
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129152807 Original CRISPR CCACATGCACACCCATGCCA GGG (reversed) Exonic
900216003 1:1482002-1482024 CCACAGACAGGCCCATGCCACGG - Intronic
900223122 1:1520005-1520027 CCACAGACAGGCCCATGCCACGG - Intronic
900376913 1:2359106-2359128 CCTCAGGCACACCCAGGCCTTGG + Intronic
900686064 1:3948399-3948421 CCACTTTCCCACCCCTGCCAAGG - Intergenic
900813697 1:4827351-4827373 ACACATGAACACCCCTGCCCAGG - Intergenic
901173891 1:7284712-7284734 CCACATGCCCACCCACCACAAGG + Intronic
902734403 1:18390639-18390661 CCACATGCACCACCATGACCAGG + Intergenic
904576185 1:31506455-31506477 CCCCACACACACCCATGCCTGGG - Intergenic
905254453 1:36671228-36671250 CCACATGGACAGTCATGCAAAGG - Intergenic
905799504 1:40834265-40834287 CCACTTGGTCACCCAAGCCATGG + Intronic
907871523 1:58448010-58448032 CCACATGCAGCCTCATGCAATGG + Intronic
908531747 1:65040634-65040656 TCACATACACACACATGCCCAGG + Intergenic
908564625 1:65341711-65341733 CCACATGCACCAGCATTCCAGGG - Intronic
909332166 1:74426501-74426523 ACACATGTACACCTACGCCAGGG + Intronic
911103114 1:94109443-94109465 GCACATGCACGCCTCTGCCAAGG + Intronic
911104540 1:94119489-94119511 CCACATGCACCAACCTGCCAGGG + Intronic
911426293 1:97717803-97717825 ACACATGCACACACACACCATGG - Intronic
912467414 1:109883540-109883562 CCCCATGCACACCCAGGGCTGGG + Intergenic
912942429 1:114056833-114056855 CCACATCCACCCCCATAGCAGGG - Intergenic
918046062 1:180941679-180941701 CCACATGCAGGACCATGGCAGGG - Intronic
919165711 1:193888882-193888904 CCACGTGGACAGCCATGGCATGG + Intergenic
919893370 1:201992384-201992406 CCATATTCACACCCATGCTCTGG + Intronic
920241415 1:204554385-204554407 ACACATGCACACTCATGACTGGG - Exonic
920659006 1:207899237-207899259 ACACATGCACACCCATGTTTTGG - Intronic
922743777 1:228031591-228031613 ACACATGCACACACATGCACAGG - Intronic
923032181 1:230257874-230257896 CCACACCCACACCCACCCCAAGG - Intronic
1062963386 10:1590123-1590145 CCACATGGGCACCCAAGACATGG - Intronic
1064989385 10:21242926-21242948 CCCCAAGCACACCCCTGCCTTGG + Intergenic
1065183327 10:23148449-23148471 CCACATGCACACACACGCACAGG - Intergenic
1067551979 10:47242677-47242699 ACACATGCAAAGCCCTGCCATGG + Intergenic
1067712708 10:48662678-48662700 CCCTGTGCACAGCCATGCCATGG + Intergenic
1069285405 10:66708536-66708558 CCAAATGCACTCTCATTCCAAGG + Intronic
1070741716 10:78907661-78907683 CCCCATGCACATCCAGCCCAGGG + Intergenic
1071201672 10:83226473-83226495 CCACATCCTCTCCCATGGCACGG + Intergenic
1071964118 10:90834865-90834887 CTACATGCACACCCCTCTCAAGG - Intronic
1072092582 10:92143273-92143295 CCAAATGTACACCCAAGCAATGG - Intronic
1072351430 10:94561216-94561238 CCACACCCACACCCATACCTTGG + Intronic
1073791116 10:106941482-106941504 CCACGTGCTGACCCATGACATGG + Intronic
1074713038 10:116193259-116193281 CCACCTCCACACCCACTCCAGGG + Intronic
1075446753 10:122518634-122518656 CCACATCCACACTCATTCTACGG - Intergenic
1076654585 10:132015205-132015227 CACCATGAACACCCATGTCAGGG + Intergenic
1076743278 10:132498788-132498810 GCACATGCACACACACACCAGGG + Intergenic
1076776317 10:132699950-132699972 CCACACTCAGACCCCTGCCAGGG - Intronic
1077027312 11:446617-446639 CCACACGCACACCTGTGCCCGGG - Intergenic
1077102635 11:828953-828975 CCACAGGCTCACCCAGGCCCAGG - Exonic
1077418562 11:2437369-2437391 CCACATGCACACTGAAGCCAGGG - Intergenic
1078718712 11:13863768-13863790 CCACATACACACCCAGGAAAGGG - Intergenic
1079238023 11:18703291-18703313 CCACATCCTCACCCACACCAGGG - Exonic
1080270728 11:30448380-30448402 CCACAAACACACCCTTGCCAGGG + Intronic
1084949610 11:72657444-72657466 CCAGATGCAGCCCCATGCCCCGG + Intronic
1085028857 11:73257717-73257739 CCACAGGGACACCAAGGCCAGGG + Intergenic
1086759531 11:90610912-90610934 CCACATGCACACACATGCCCAGG - Intergenic
1089742048 11:120591231-120591253 CCAGGTGCACAGCCATGCCCAGG - Intronic
1093873088 12:24316049-24316071 CTGCAGGCACAGCCATGCCAGGG + Intergenic
1096112596 12:49038301-49038323 CCACATCCACACCCAGACCCAGG + Exonic
1096546380 12:52342932-52342954 CAACATGCAGACCCAGGTCATGG - Intergenic
1097369494 12:58759181-58759203 ACACACGCACACACACGCCATGG + Intronic
1098628588 12:72702172-72702194 CAACATGGACACCCTTGTCAAGG + Intergenic
1098907772 12:76179451-76179473 CCAAAAGAACACCCATGCCAGGG - Intergenic
1101512452 12:105405486-105405508 TTAAATGCACACCCATGCCTGGG - Intergenic
1102556287 12:113728864-113728886 TAACATGCACACACATGCCCTGG + Intergenic
1102809515 12:115812313-115812335 ACACATCCACAACCCTGCCATGG - Intergenic
1104781234 12:131421896-131421918 CCACAAGAACAGCCATGCCTGGG - Intergenic
1104860704 12:131921924-131921946 ACATATGCAGACACATGCCAGGG + Exonic
1105899561 13:24743521-24743543 CCACCTGCCCACCCTTGACATGG - Intergenic
1106682988 13:32027524-32027546 GCTGATGCAGACCCATGCCAGGG + Intergenic
1107411305 13:40161026-40161048 CCACATGCACACATACACCATGG - Intergenic
1107646937 13:42504165-42504187 ACACAGGTACACACATGCCATGG + Intergenic
1107789941 13:43991793-43991815 CCTCATGCACTCACTTGCCAGGG - Intergenic
1108574401 13:51779081-51779103 CTGCATGCCAACCCATGCCAAGG + Intronic
1109061654 13:57629623-57629645 CCGCACACACGCCCATGCCAAGG - Intergenic
1109074374 13:57815603-57815625 CACAAGGCACACCCATGCCACGG - Intergenic
1112416725 13:99209075-99209097 CCACATGCACAGCCAGGGCAAGG - Intronic
1113418444 13:110150644-110150666 CCAGCTGCACACCCAGGCCCTGG + Intronic
1115128898 14:30029150-30029172 CTACATTCACACCATTGCCAAGG + Intronic
1116409819 14:44608208-44608230 CCAGATCCACACCCATCCTAGGG - Intergenic
1117022506 14:51585916-51585938 ACACACACACACACATGCCATGG - Intronic
1117298698 14:54402293-54402315 ACACACGCACACACATGCCATGG - Intronic
1121108413 14:91295804-91295826 CCAAATGCAGTCCCATGCTAGGG - Intronic
1121334444 14:93068975-93068997 CCTCCTGCACCCCCATGCCCAGG + Intronic
1122863364 14:104592728-104592750 CCACACACAGACCCCTGCCATGG + Intronic
1122998787 14:105280775-105280797 CCACCTGCACACCCAGGCTCAGG - Intronic
1123114309 14:105886963-105886985 CAAGATGCACACCCATGCACAGG - Intergenic
1202897072 14_GL000194v1_random:16499-16521 CCAGATGGACATCCATCCCAAGG + Intergenic
1124069400 15:26377699-26377721 ACACATGCACCCTCTTGCCATGG + Intergenic
1125117183 15:36108262-36108284 CCACATGCACACACATTACAAGG + Intergenic
1125737470 15:41937210-41937232 CCACATGCGCCCACCTGCCATGG + Intronic
1128349052 15:66876980-66877002 TCACAGGCACACACATGACACGG + Intergenic
1128796335 15:70469422-70469444 CACTATGCACTCCCATGCCATGG + Intergenic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1129691870 15:77718361-77718383 TCACATGCACAGCCATGCGTGGG - Intronic
1129714255 15:77837831-77837853 CTGCATGCGCACCCAGGCCAGGG - Intergenic
1129750421 15:78059008-78059030 CAAAATGCACACCCAGGTCAGGG - Intronic
1130124975 15:81085642-81085664 CCCCATGCAGACCCCTTCCAAGG + Intronic
1130273594 15:82465045-82465067 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130465946 15:84192416-84192438 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130498319 15:84481120-84481142 CTGCATGCTCAGCCATGCCATGG + Intergenic
1130588234 15:85197012-85197034 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130837054 15:87661658-87661680 CTACCTCCACACCCATGCCTAGG - Intergenic
1131456483 15:92586113-92586135 ACACATGCACTCTCATGTCATGG - Intergenic
1131943413 15:97592650-97592672 CCACATGCACTCACTTGCTAAGG + Intergenic
1132041210 15:98525704-98525726 CCACACACACACCCCTGCCCTGG + Intergenic
1132990390 16:2789580-2789602 CCTCATGCACACAGAGGCCACGG - Intergenic
1134056304 16:11171848-11171870 ACACAGTCACACACATGCCAGGG + Intronic
1135860977 16:26055710-26055732 CCATATGCACCCACATGCAATGG - Intronic
1138532892 16:57644624-57644646 ACACATGCACACTCATGCATGGG + Intronic
1138532921 16:57644992-57645014 ACACATGCACACTCATGCATGGG + Intronic
1138767369 16:59620423-59620445 ACACATGCACACCCATATAAAGG - Intergenic
1138956233 16:61973616-61973638 CCACATGCACAGTAATGCAAAGG + Intronic
1138966141 16:62086203-62086225 ACACAGGTACACACATGCCATGG - Intergenic
1139975488 16:70806725-70806747 GCAGAAGCAAACCCATGCCAGGG + Intergenic
1140141364 16:72261174-72261196 CCAAATGCCCCTCCATGCCATGG + Intergenic
1141140706 16:81495123-81495145 ACATATGCAAACCTATGCCACGG - Intronic
1141621524 16:85238894-85238916 CCACCTGCACACCCGGGCCTGGG + Intergenic
1142012711 16:87724787-87724809 CCACACCCACACCCACCCCAGGG + Intronic
1146218304 17:30996552-30996574 CCACAGGCACACCCTAGACAAGG + Intronic
1147677378 17:42217483-42217505 CCAGCTCCAAACCCATGCCAGGG + Intronic
1147969462 17:44211840-44211862 CCACTCGCCCACCCATCCCAGGG + Intronic
1148544706 17:48508764-48508786 CCACATGCACACCTGTACCATGG - Intergenic
1148595617 17:48852862-48852884 ACACATGCACACACACACCATGG - Intronic
1148609414 17:48954441-48954463 CAACCTGTCCACCCATGCCATGG - Intergenic
1149536954 17:57440701-57440723 TCACATCCACACCCATGCACAGG - Intronic
1150446174 17:65228387-65228409 CCACCAGCATATCCATGCCAAGG - Intergenic
1150459016 17:65331476-65331498 CCAGTTGTACACCCATGTCATGG - Intergenic
1152841033 17:82568308-82568330 CCACATCCCCACCGATGCCCTGG - Intronic
1155244583 18:23895028-23895050 GCACATGGAGACCCAGGCCAAGG + Exonic
1156464969 18:37342920-37342942 CCACAGACACCCACATGCCATGG - Intronic
1156504048 18:37577795-37577817 CCCCTGTCACACCCATGCCAAGG + Intergenic
1157393458 18:47322396-47322418 ACACATGCACTCACATGCCAAGG - Intergenic
1157502955 18:48203674-48203696 CCACAGGAACACCCAACCCAGGG - Intronic
1157971649 18:52276710-52276732 ACACATGCACACTTATACCAAGG - Intergenic
1160436993 18:78859320-78859342 CCACACCCACACCCATGGGAAGG + Intergenic
1161451119 19:4345948-4345970 CCAGCTGCACACGCCTGCCACGG + Exonic
1161589406 19:5122330-5122352 CCAGATGCTCTCCCATGTCAGGG + Intronic
1162780550 19:13004700-13004722 CCACATGCCCATCCCTGCCCAGG + Intronic
1163497415 19:17654987-17655009 CCACATACACACACAGCCCAGGG - Intronic
1163625308 19:18386176-18386198 CAACCTGCACAGCCATGCCCGGG + Exonic
1164960221 19:32421755-32421777 CTGCCTGCACACCCATCCCATGG - Intronic
1165590143 19:36961945-36961967 CCCCATGCACCACCATGCCTGGG + Intronic
1166701707 19:44886032-44886054 CCACCTCCACACCCACCCCAGGG + Intronic
1168305476 19:55433070-55433092 ACACAGGCGCACACATGCCAGGG - Exonic
926745622 2:16154658-16154680 CTCCCTGCACACCCAAGCCAAGG + Intergenic
927849575 2:26490471-26490493 GCACCTGCACACCCAGGCCAGGG - Intronic
930037871 2:47099154-47099176 TCACAGGAACACACATGCCAAGG + Intronic
930880920 2:56269324-56269346 ACACACACACACCCTTGCCAAGG - Intronic
931185276 2:59945017-59945039 AGTCATCCACACCCATGCCAAGG + Intergenic
931859842 2:66343418-66343440 CCACATGCCATCCCATGCCCAGG - Intergenic
931890835 2:66670257-66670279 CCACATACACACACATGTCCTGG + Intergenic
934713440 2:96529929-96529951 CCAGCTGCCCACCTATGCCATGG - Intergenic
936249147 2:110854088-110854110 AGACATGCACACACATGCCTTGG - Intronic
937318810 2:120948555-120948577 CCACATGCACACCACTGTCTGGG - Intronic
937840108 2:126516440-126516462 ACACATTCACACACATGCAATGG - Intergenic
938249641 2:129804843-129804865 CCACATGAACACACAGGGCACGG + Intergenic
938314282 2:130315386-130315408 CCACAGGAACACCCATCACAGGG - Intergenic
944286708 2:197958448-197958470 CCACATGCAGCCACAGGCCATGG + Intronic
947238063 2:227964611-227964633 CCACATACACACCTATGCCTAGG - Intergenic
947711063 2:232316099-232316121 ACACAGACACACCAATGCCAGGG - Intronic
948501785 2:238399745-238399767 CGGTATGCACACCCATGCAAAGG - Exonic
948639444 2:239365649-239365671 AGACATGCACACACAAGCCAGGG + Intronic
948786017 2:240353361-240353383 CCTCAGGCACACCCACTCCAAGG + Intergenic
948821529 2:240551677-240551699 CCACATGGTCACCCATGGTATGG + Intronic
949064791 2:241983505-241983527 CCCCAAGCCCACCCACGCCAGGG - Intergenic
1168773820 20:432566-432588 CCCAAGGCTCACCCATGCCAGGG + Intergenic
1168986790 20:2056016-2056038 GGACATGCACATCCATGACATGG + Intergenic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1171326442 20:24297797-24297819 GCCCATGCCCACCCAAGCCAGGG + Intergenic
1175686418 20:61031598-61031620 GCCCATGCTCACCCATGCCCAGG - Intergenic
1175901386 20:62361239-62361261 CCACACCCAGACCCAGGCCAGGG + Intronic
1175942862 20:62545994-62546016 CCTCATCCACACCCAGGCCCAGG + Intergenic
1175948232 20:62568588-62568610 CCACATTCTCACCCCTCCCAGGG - Intronic
1176616758 21:9032488-9032510 CCAGATGGACATCCATCCCAAGG + Intergenic
1177511437 21:22092130-22092152 CCACTCACAAACCCATGCCACGG - Intergenic
1177878240 21:26661015-26661037 CCACATGGTCACCCATGGTATGG - Intergenic
1178747741 21:35269483-35269505 TCACATGCACACCCTGACCATGG - Intronic
1179057401 21:37948768-37948790 GCACCTGAACAGCCATGCCACGG - Intergenic
1179353928 21:40640850-40640872 CCACACGCACACACACACCAGGG + Intronic
1180099976 21:45579549-45579571 CCAGGTGCACCCCCATCCCAGGG - Intergenic
1180137334 21:45870444-45870466 CCCCATGCACACCCTTCCTAGGG + Intronic
1180610497 22:17093874-17093896 CCACAAGCACACCCATGGAGGGG - Intronic
1180917964 22:19502502-19502524 CCACATACACACACATACAAAGG + Intronic
1181163633 22:20971999-20972021 CCACATGCATTCCCATGCTCAGG + Intronic
1182994986 22:34803634-34803656 CCACAAGCCCAACGATGCCAGGG - Intergenic
1183196499 22:36357369-36357391 CCACATACAAAACGATGCCACGG + Intronic
1183240036 22:36650840-36650862 CCACAGGCACACTCCTGCCTCGG + Intronic
1183547182 22:38460605-38460627 CCACCTGCACACACACACCATGG + Intergenic
1183739434 22:39661912-39661934 CCACAGGCACACCCACGGCTGGG - Intronic
1183747614 22:39700644-39700666 ACACAAGCACACCCATCTCATGG + Intergenic
1184274200 22:43400793-43400815 CCGCACACACACCCGTGCCATGG - Intergenic
1184813282 22:46851958-46851980 CCAAATGCACAACAAAGCCAGGG - Intronic
1185053354 22:48565143-48565165 CCACATGCCCTCACATGGCAGGG - Intronic
950472742 3:13196711-13196733 ACACACGCACGCGCATGCCAGGG - Intergenic
950585786 3:13891018-13891040 CCTCATGCACACACATTCCCTGG + Intergenic
950612462 3:14135040-14135062 CCACCTCCACACCCGTGCCCAGG - Intronic
952904517 3:38130960-38130982 CCAGATGCCCACCCAAGCCTGGG + Intronic
953374437 3:42416975-42416997 ACACATACACCCCCATGCCCCGG + Intergenic
953849307 3:46454079-46454101 CCTCATAGACACCCATGCCTAGG - Intronic
954447757 3:50555711-50555733 CCACAGGCAGACCCAGGCCCAGG + Intergenic
957894360 3:86402157-86402179 CCACACACACACACGTGCCAAGG + Intergenic
962144863 3:132830164-132830186 CCATTTGGCCACCCATGCCATGG + Intergenic
963067775 3:141277615-141277637 TCACATGTCCACCCCTGCCAGGG + Intronic
964626678 3:158766473-158766495 CCAAATGCACAACCATGTGATGG + Intronic
965132696 3:164722315-164722337 ACACACACACACACATGCCATGG - Intergenic
965604506 3:170485157-170485179 CCACTAGCACACACATGCAAGGG - Intronic
966029555 3:175328213-175328235 CCACATACACACCCATGTGTGGG + Intronic
966763158 3:183434874-183434896 ACACATACACCCCTATGCCAGGG - Intergenic
967497644 3:190159759-190159781 CCACATTCTCACTCTTGCCAAGG + Intergenic
967635811 3:191801638-191801660 GCACCTGCACACTCATTCCAGGG + Intergenic
968708532 4:2095517-2095539 CCTCGTCCACACACATGCCAAGG - Intronic
976983329 4:91260305-91260327 ACACATACACACCCATGCATGGG + Intronic
979083739 4:116378936-116378958 GCACATGCACACTCAGCCCATGG - Intergenic
980001437 4:127493744-127493766 CCACACGTACACCCAAACCATGG + Intergenic
981103808 4:140858184-140858206 CCAGAGTCACACGCATGCCAGGG - Intergenic
983650399 4:170031294-170031316 ACACATGCACACCCCTCCAAGGG - Intronic
985985741 5:3514976-3514998 CCAGATGCACACCCCAGCCAGGG + Intergenic
986081937 5:4403846-4403868 ACACATGCACATACATGCAAAGG - Intergenic
986335663 5:6753512-6753534 CCACAAGGGCACGCATGCCAGGG - Intronic
987095105 5:14542631-14542653 CCACATGTACTCCCAGGGCAGGG - Intergenic
990816429 5:59790947-59790969 CCACATGGGCACACATCCCAGGG - Intronic
990831291 5:59961347-59961369 CCTCATGAAGCCCCATGCCAAGG + Intronic
991950068 5:71938927-71938949 CCACATGCACACTCATCCCGGGG - Intergenic
991962124 5:72055506-72055528 CCACTTGCACACTCATGCCAAGG + Intergenic
991995059 5:72378594-72378616 TCACATGCAAACCTATGCTATGG - Intergenic
995317104 5:110787945-110787967 ACACAGGCATACACATGCCATGG + Intergenic
996720799 5:126628316-126628338 CCCCACACACACCCGTGCCATGG - Intergenic
996821842 5:127638079-127638101 CCAGATGCACTCCCATGTCCTGG - Intergenic
997954096 5:138264872-138264894 CCCCAGGCAGAGCCATGCCATGG + Intronic
998451027 5:142234932-142234954 ACTCCTGCACACCCCTGCCAAGG + Intergenic
999374258 5:151075936-151075958 CCACACACACACCCCTGCCTGGG + Intronic
1000722109 5:164721016-164721038 CCATATGCAAAGCCATGCTATGG + Intergenic
1001211420 5:169813497-169813519 CTACCAGCACACCCCTGCCAGGG + Intronic
1001991039 5:176115507-176115529 AGACCTGCACACCCATCCCAGGG + Intronic
1002225833 5:177722633-177722655 AGACCTGCACACCCATCCCAGGG - Intronic
1002268016 5:178048579-178048601 AGACCTGCACACCCATCCCAGGG + Intronic
1005358434 6:25007750-25007772 CCACATTTACATCCATGCCCAGG + Intronic
1007810816 6:44484584-44484606 CCATGTGCACACACATGCCCTGG + Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1015533448 6:134244039-134244061 ACACAGGCATACACATGCCATGG + Intronic
1015897985 6:138035238-138035260 AGACAGGCACACCCATCCCAGGG - Intergenic
1016922283 6:149307438-149307460 CCACACCCCCACCCCTGCCAAGG + Intronic
1019601824 7:1888143-1888165 ACACATGCACACACATGCACAGG - Intronic
1023125702 7:36952105-36952127 TCCCACGCAAACCCATGCCAGGG + Intronic
1023914902 7:44581746-44581768 CCACGTGCATGCCCAGGCCAGGG + Exonic
1024276683 7:47683100-47683122 CAGCATTCACACCCATCCCAGGG + Intergenic
1027422974 7:78035147-78035169 CCGCATCAGCACCCATGCCAGGG - Intronic
1028610988 7:92711403-92711425 CCTCATGCACACCCATACTGAGG + Intronic
1031875733 7:127138685-127138707 ACACATACACACATATGCCAAGG + Intronic
1034971911 7:155424480-155424502 CCACAATCACAACCAAGCCAAGG - Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035547681 8:496283-496305 CCACATGCTCTGTCATGCCATGG - Intronic
1035587702 8:788389-788411 CCACGTGGACACGGATGCCAAGG - Intergenic
1037757786 8:21722623-21722645 CCACACGCAGACCCATACGAAGG + Intronic
1038496344 8:28006120-28006142 ACACATGCACACACTTCCCAAGG - Intergenic
1039824439 8:41161202-41161224 CCACATGAACACCCATCCCCAGG + Intergenic
1040493873 8:47949090-47949112 CCAGAGGCACCCCCATGCCTTGG + Intronic
1040543257 8:48378183-48378205 CCACCTGCAAACCATTGCCATGG + Intergenic
1041124367 8:54620672-54620694 TCACATATACACCCATGCAATGG - Intronic
1041411945 8:57565708-57565730 CCAAATGCACTGCCATGCCCAGG - Intergenic
1047174370 8:122526674-122526696 CCGCATGCACACCCCACCCATGG + Intergenic
1047662092 8:127048163-127048185 CCACATGTATACACATGCCATGG - Intergenic
1049251702 8:141592725-141592747 CCACACACACACCCAAGCCGAGG - Intergenic
1049442345 8:142615135-142615157 ACCCATGCACACCAACGCCAGGG - Intergenic
1049578630 8:143400896-143400918 CCAGCTGCACACCCAGGCCCTGG - Intergenic
1049797383 8:144502980-144503002 CCACTTGGACTCCCTTGCCAGGG + Intronic
1049833539 8:144718003-144718025 CCACAAGCCCTCCCATGCCCCGG + Intergenic
1052784600 9:32816851-32816873 CTGCATGTACACCCCTGCCAGGG + Intergenic
1056136475 9:83633948-83633970 CCACAAGCACATCCATGGTAGGG + Intronic
1057172333 9:92970260-92970282 ACCCATGCACACCCATGCCCAGG - Intronic
1060457297 9:123810674-123810696 CCACATACAGCCCCAGGCCATGG + Intronic
1061206507 9:129167038-129167060 CCACAAACACACCCATCCAAGGG - Intergenic
1061480777 9:130896801-130896823 ACACATGCACACACAGGACAGGG - Intergenic
1061753772 9:132798804-132798826 CCCCATCTACCCCCATGCCAAGG - Intronic
1061995463 9:134180749-134180771 CAGCATGCACCCACATGCCAGGG + Intergenic
1062150552 9:135016428-135016450 ACACATTCACCCACATGCCAGGG + Intergenic
1062262091 9:135667808-135667830 CCACATCTACCCCCATGCCCAGG - Intergenic
1062609136 9:137365660-137365682 CCACACGCACACACATGCACAGG + Intronic
1062673595 9:137725985-137726007 CCACATGTTCACCCATGTCATGG + Intronic
1187942924 X:24399161-24399183 CTACATGCATACCAATACCAAGG - Intergenic
1188970231 X:36606286-36606308 CCAAAGGCACAGACATGCCAAGG - Intergenic
1193696148 X:84709219-84709241 CCACATGCAAACCCCTTGCAGGG - Intergenic
1194176469 X:90655309-90655331 CCACATGATCACCCATGGTATGG + Intergenic
1195665698 X:107428349-107428371 CCACATTCCCAACCATGTCAGGG + Intergenic
1200116632 X:153772420-153772442 CCACCTCCACTCACATGCCATGG - Intronic
1200117137 X:153774351-153774373 CCACCTGCCCACCCAGGGCACGG - Intronic
1200523096 Y:4236221-4236243 CCACATGATCACCCATGGTATGG + Intergenic
1201150160 Y:11091339-11091361 CCAGATGGACATCCATCCCAAGG + Intergenic
1202369274 Y:24186248-24186270 CTGCATGCTCAGCCATGCCATGG + Intergenic
1202501511 Y:25483869-25483891 CTGCATGCTCAGCCATGCCATGG - Intergenic