ID: 1129153823

View in Genome Browser
Species Human (GRCh38)
Location 15:73705145-73705167
Sequence GCCTCTGGTCAGTCACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129153816_1129153823 9 Left 1129153816 15:73705113-73705135 CCGCAGTCTCCATCTGTGTTTGG 0: 1
1: 0
2: 1
3: 33
4: 296
Right 1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG 0: 1
1: 0
2: 3
3: 12
4: 176
1129153818_1129153823 0 Left 1129153818 15:73705122-73705144 CCATCTGTGTTTGGCCCTGAGAG 0: 1
1: 0
2: 0
3: 21
4: 197
Right 1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG 0: 1
1: 0
2: 3
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129153823 Original CRISPR GCCTCTGGTCAGTCACTTCC TGG Intronic
900363343 1:2300393-2300415 GCCTCTGGTGTGACCCTTCCTGG - Intronic
900463186 1:2811040-2811062 ACCTCTGGGCAGCCACCTCCAGG + Intergenic
900497917 1:2984723-2984745 ACCACTGGCCAGTCACTTTCTGG + Intergenic
904819364 1:33231471-33231493 GCCCAGGGTCAGTCACTTACTGG - Intergenic
905901544 1:41584726-41584748 TCCTTTGGTCAGCCGCTTCCGGG + Exonic
907721384 1:56975401-56975423 GCCTCTGGTCAGGCAGGACCGGG - Intergenic
910929655 1:92430482-92430504 GCCTCAGGTCTGACACATCCTGG - Intergenic
911983766 1:104597645-104597667 TCCTCAGGTCAGTCCCTGCCAGG + Intergenic
912334048 1:108846227-108846249 GCCTGTGGTCTGGGACTTCCAGG - Intronic
912561688 1:110555728-110555750 GCCTCTGGTCCGTCCCGCCCCGG - Intergenic
914811818 1:151034224-151034246 GCCTCTCAACAGTCACTTCTTGG - Exonic
915438899 1:155931517-155931539 GCCACTGCACAGTCACTGCCTGG + Intronic
915671591 1:157493606-157493628 ACCTGTGGTCAGTCCCTACCAGG - Intergenic
919773288 1:201176739-201176761 GCCTCTGGCCTCTCACCTCCTGG + Intergenic
920440329 1:205976285-205976307 GCCTCTGTTCTGTCACAACCAGG - Intergenic
922178748 1:223217169-223217191 GGCTCTGTTCAGTCATATCCAGG + Intergenic
923525411 1:234768765-234768787 GCCTGTGGTCAGTCACTGAGGGG - Intergenic
924483738 1:244460411-244460433 TCCTGTGCTGAGTCACTTCCTGG - Intronic
1063382891 10:5597279-5597301 GCCTCTGCTCAGACGCTTCCAGG - Intergenic
1065176672 10:23082795-23082817 GCCTCTGGTCATTGATCTCCTGG - Intergenic
1067130009 10:43555340-43555362 ACCTCTGGTCAGCCACGTACAGG + Intergenic
1067805018 10:49386339-49386361 GCCTCCTGTCAGTCACAGCCAGG - Intronic
1070764596 10:79049048-79049070 GCCTCTGGGCCGAGACTTCCTGG + Intergenic
1071282448 10:84114872-84114894 ACATCTGGTCAGTCGTTTCCTGG - Intergenic
1071463312 10:85918793-85918815 CCTTCTGCTCAGGCACTTCCTGG - Intronic
1073189369 10:101639982-101640004 GCCTCTGTTCAGTAACTGCTCGG + Intronic
1074774917 10:116760475-116760497 ACCTCTGATCAGTCAGTCCCTGG + Intergenic
1076150985 10:128161833-128161855 GCCTCAGGTCAGTTGCTTCCTGG + Intergenic
1076794336 10:132791397-132791419 GCCTCTGGTCACTCCCACCCAGG - Intergenic
1078667093 11:13334792-13334814 GCCTCTAGCCAGGCTCTTCCAGG + Intronic
1079003844 11:16778997-16779019 GTCACGGGTCAGTCACTGCCTGG + Intronic
1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG + Intergenic
1080563716 11:33488664-33488686 ACCTCTGATCTGTTACTTCCTGG - Intergenic
1080868346 11:36214688-36214710 GTCTCAGCTCAATCACTTCCTGG + Intronic
1080895638 11:36447042-36447064 GCCACTGGGCAGTCTCTTACTGG - Intronic
1082847227 11:57736139-57736161 GAGTCTGTTCAGTCACTTCAGGG + Intronic
1083184074 11:61007538-61007560 CTCTCTGGTCTGACACTTCCAGG + Exonic
1085289281 11:75385985-75386007 CCCGCTGGTCAGGCTCTTCCTGG + Intergenic
1088459751 11:110070199-110070221 GCCTCTGATCTGTCTCCTCCTGG + Intergenic
1088698638 11:112392096-112392118 TTCCATGGTCAGTCACTTCCTGG + Intergenic
1091813230 12:3417086-3417108 GCCTCTGCTCAGGCACTTAATGG - Intronic
1092178289 12:6426262-6426284 CTCTCTGCTCAGTCACTTGCTGG - Intergenic
1092846053 12:12586285-12586307 GTCTCAGGTAAGTCCCTTCCAGG - Intergenic
1093930482 12:24950599-24950621 GGCTGTGGTCAGTTACTTTCAGG - Intergenic
1101412486 12:104481026-104481048 ACCTCTGCTGAGTCACATCCCGG - Intronic
1102825466 12:115944606-115944628 GACTCCAGTCAGTCACTACCAGG + Intergenic
1104456267 12:128915028-128915050 GCATCTTGTCAGTTACTTTCAGG + Intronic
1104780813 12:131419044-131419066 ACCTCTGGGCAGCCACATCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1113765397 13:112877798-112877820 GCCTGTGGTCAGACACATCCGGG - Intronic
1114643134 14:24238010-24238032 GCCTCTGGAGAGTCCCTGCCTGG - Intronic
1115201838 14:30862107-30862129 GCCGCTGGGCATTCACTTCGTGG - Intergenic
1116616539 14:47147759-47147781 GACTCTGGTTAGTCTCTTTCTGG + Intronic
1116928645 14:50668172-50668194 GTCGCTGGTCAGTTCCTTCCCGG + Exonic
1117022348 14:51584283-51584305 GCCTCTTGTCTCTCCCTTCCAGG - Intronic
1119196739 14:72722816-72722838 GAGACTGGTCAGGCACTTCCAGG - Intronic
1119998460 14:79278392-79278414 GCCTTGGGTCAGTCCCCTCCTGG + Intronic
1120718959 14:87869787-87869809 GCCTGAGGTCAGTCATTGCCTGG + Intronic
1122250283 14:100434214-100434236 GCCTCTATTCAGTTATTTCCAGG + Intronic
1122594410 14:102879193-102879215 GCCTCCCTTCAGTCACTTCATGG - Intronic
1122906374 14:104803464-104803486 GCCTCTGCTCAGTCAGTGCACGG - Exonic
1125597834 15:40899028-40899050 GTCTCTGGTCAGTCACTGCCTGG + Intronic
1127564062 15:60169221-60169243 GCCTTTGGTCAGTGTCTACCTGG - Intergenic
1127871831 15:63080365-63080387 GCCACTGGGCAGGCACTTCCTGG - Intergenic
1128830945 15:70767900-70767922 GCCTCAGGTCTCTCATTTCCTGG - Intergenic
1129076216 15:72998469-72998491 TCCTCTGGCCAGCCTCTTCCGGG - Intergenic
1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG + Intronic
1130553097 15:84904483-84904505 TCCTCTGGTCAGTCTAATCCTGG + Intronic
1132729197 16:1352257-1352279 GCCTCAGGCCAGTCGCCTCCAGG + Exonic
1133680100 16:8113267-8113289 TCTTCTGCTCAGTCAGTTCCTGG - Intergenic
1133885491 16:9823788-9823810 GCCTGTGGTCAGACGCATCCGGG - Intronic
1136078621 16:27837000-27837022 GGCTCTGCCCAGTTACTTCCAGG + Intronic
1140536985 16:75718961-75718983 GCCTCTGTTCGCTCACTTTCAGG - Intronic
1143783048 17:9239523-9239545 CACTCTGTGCAGTCACTTCCTGG + Intronic
1144052084 17:11505565-11505587 GACCCTGATCAGTGACTTCCAGG + Intronic
1144949907 17:18988559-18988581 GCCCCTGGCCCCTCACTTCCTGG - Intronic
1147882598 17:43663648-43663670 GCCCCAGGTCTGCCACTTCCTGG + Intergenic
1148738642 17:49879681-49879703 ACCTCTGGTCACTCACTGTCTGG - Intergenic
1151390725 17:73785153-73785175 GCCACTGGACTGTCAGTTCCAGG + Intergenic
1152009194 17:77700551-77700573 GCCTCTTCTCATTCACCTCCAGG - Intergenic
1152231561 17:79116593-79116615 GCTTCTGCACAGTCACTTCCAGG - Intronic
1152259105 17:79257166-79257188 GCCCCAGGACAGTCACTTCCCGG - Intronic
1153960496 18:10136052-10136074 TCCTCCAGTCAGTCACGTCCCGG - Intergenic
1156363008 18:36400758-36400780 GGCTGTGGACACTCACTTCCTGG - Intronic
1158591132 18:58779777-58779799 CTTTCTGGTCAGTCACTTCCAGG + Intergenic
1159045520 18:63366446-63366468 TCCCCAGGTGAGTCACTTCCTGG + Intronic
1161251386 19:3282261-3282283 GCCTCTGGTGAGCCTCCTCCAGG + Exonic
1163368107 19:16887651-16887673 GACTCTGCTCAGTCACTTCCTGG + Intergenic
1164159206 19:22615794-22615816 GCCTCTGGTCAAACAGTTACAGG + Intergenic
1164948791 19:32318670-32318692 GCCCCAGCTCAGTCACCTCCAGG - Intergenic
1165097739 19:33418856-33418878 GCTTCAGGTCAGTCCCTTCTTGG - Intronic
925010884 2:485232-485254 GGCTCTGGTCAATTCCTTCCGGG - Intergenic
925166923 2:1721480-1721502 GCCTGGAGTCAGTTACTTCCTGG - Intronic
925714559 2:6772457-6772479 TCCTCCCATCAGTCACTTCCTGG - Intergenic
926185787 2:10689780-10689802 TCCTGAGGTGAGTCACTTCCCGG - Exonic
927512944 2:23655813-23655835 CACTCTGCTCAGTCAGTTCCAGG - Intronic
929302952 2:40326757-40326779 GACTCCTTTCAGTCACTTCCAGG + Intronic
930294567 2:49538415-49538437 TCTTCTGCTAAGTCACTTCCTGG - Intergenic
931937932 2:67218908-67218930 TCCTCTGCTCAGGGACTTCCAGG + Intergenic
932368198 2:71166518-71166540 GCCTCTGGTCACCCACCTCGAGG - Intergenic
934780956 2:96969422-96969444 GGTTCTGGTCAGTCGGTTCCTGG - Intronic
935148137 2:100410160-100410182 GCCTGTGGGCAGTCACTGCGGGG + Intronic
936075992 2:109402233-109402255 TCCTCAGGCCAGGCACTTCCTGG - Intronic
938288608 2:130137819-130137841 GCCTCCTGTCAGACACTTCTAGG + Intergenic
938426981 2:131201068-131201090 GCCTCCTGTCAGACACTTCTAGG - Intronic
938467925 2:131535113-131535135 GCCTCCTGTCAGACACTTCTAGG - Intergenic
939914684 2:148024015-148024037 GTCCCTGCTCTGTCACTTCCAGG - Intronic
940887295 2:159000800-159000822 GACTCTGGCCAGCCATTTCCAGG - Intronic
944129063 2:196326299-196326321 GCCACTGGTGAGCCACCTCCTGG - Intronic
944516004 2:200512228-200512250 CCCTCTGCTCAGTCACTGGCTGG + Intronic
945121112 2:206458268-206458290 GCCTCTGGTCAGTCATTAATTGG - Intronic
946693826 2:222332682-222332704 GCCTCTGGTCAGCCATTTTGAGG - Intergenic
947614849 2:231549327-231549349 CCCTCTGGTCTGTAAGTTCCAGG + Intergenic
947749965 2:232526768-232526790 GCCTATGGCCACTCCCTTCCTGG + Intronic
1169727304 20:8749433-8749455 GACTATGGTCAATCACTTGCGGG - Intronic
1170509836 20:17065197-17065219 GTCTCTGGGCTGCCACTTCCAGG - Intergenic
1171408746 20:24931837-24931859 ACATCAGGTCAGTCATTTCCTGG - Intergenic
1172779523 20:37427660-37427682 GCCTCTGATTAGCCATTTCCTGG + Intergenic
1178515652 21:33244874-33244896 GCCACTGTTCAGTCATTTCTTGG - Intronic
1180800141 22:18627841-18627863 GCCCCTCGTCAGGCATTTCCAGG + Intergenic
1181108160 22:20586753-20586775 GCCTCCTGTCAGACACTTCTAGG + Exonic
1181221575 22:21367425-21367447 GCCCCTCGTCAGGCATTTCCAGG - Intergenic
1181842467 22:25675684-25675706 GCCTCTGCTCAGGCACTTCCTGG + Intronic
1181847437 22:25723027-25723049 GCCTCTGACCAGTCTGTTCCGGG + Exonic
1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG + Intronic
1183339857 22:37274131-37274153 GGATATGGCCAGTCACTTCCTGG + Intergenic
1183688424 22:39375073-39375095 ACCTCTGCTCCGTGACTTCCAGG + Intronic
1183937931 22:41274508-41274530 GCCTGTGTCCAGTCTCTTCCAGG - Intronic
1184562705 22:45272669-45272691 GCCGCTGGTCAGGCACTGCCTGG + Intergenic
1184738453 22:46412651-46412673 GCTCCTGGTCAGTCCCTCCCAGG + Intronic
1185089751 22:48759205-48759227 GACTCTGTTCAATCATTTCCTGG + Intronic
950184180 3:10934935-10934957 GCCTCTGGCTAGTCTGTTCCTGG + Intronic
950521138 3:13498740-13498762 GGCACTGGTCAGTCTCTCCCAGG - Intronic
951780225 3:26354832-26354854 GCCTTTGCCCACTCACTTCCTGG + Intergenic
955713143 3:61801060-61801082 CCCTCTGGGAAGTGACTTCCTGG + Intronic
961354478 3:126327342-126327364 GCCTCTGTTCAGGAGCTTCCTGG - Intergenic
963235463 3:142951705-142951727 GACTTTGGTCAGTGGCTTCCTGG - Intronic
967316379 3:188154665-188154687 GCCTCTAGTAAATAACTTCCGGG - Intronic
970511401 4:16785316-16785338 GCCTTTTCTCAATCACTTCCTGG + Intronic
971375070 4:26049854-26049876 GCCTCTTCTCAGTCCCTTCTTGG - Intergenic
973304022 4:48623628-48623650 GCCTATGGTCATTCACTTCGTGG - Intronic
975245561 4:72116953-72116975 GCCTCTGGTCAGACAGATACAGG - Intronic
975404770 4:73976704-73976726 ACCTCAGATCACTCACTTCCTGG + Intergenic
978577851 4:110203704-110203726 GCCTCTGGTCAGACAGTTACAGG + Intergenic
986565719 5:9111748-9111770 GTCTCTGAACAGTCTCTTCCAGG - Intronic
987470866 5:18325597-18325619 GCCTCTGGGCAATCTCTCCCTGG - Intergenic
988312025 5:29571733-29571755 GCCTCTGGTCTCTTACTGCCAGG + Intergenic
989565321 5:42895769-42895791 GCTTCAGGTCAGACAATTCCAGG - Intergenic
991949542 5:71934000-71934022 GACTCAGCTCAGTCACATCCAGG - Intergenic
993344963 5:86771300-86771322 GCCTCAGGCTAGTGACTTCCAGG + Intergenic
995474050 5:112530329-112530351 ACATCTGGCCAGTCATTTCCTGG - Intergenic
995826678 5:116307156-116307178 GCCTCTGCTAAGACACTTACAGG - Intronic
1004619262 6:17319181-17319203 GCCTCTGGTCAAACAGTTACAGG + Intergenic
1007238283 6:40406593-40406615 CCCTCTGCTCACACACTTCCAGG + Intronic
1007810658 6:44483321-44483343 GCCTCTGCTCAGTGACGACCAGG - Intergenic
1008075152 6:47138236-47138258 GGCTGGGCTCAGTCACTTCCTGG - Intergenic
1014514430 6:122363167-122363189 GCCCCTGGTCAATCACTTGCAGG - Intergenic
1017251568 6:152285594-152285616 GCCCCACTTCAGTCACTTCCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1027228105 7:76257410-76257432 GTCTCTGGAGGGTCACTTCCAGG + Intronic
1027524880 7:79255685-79255707 GAGTCTGGTAAGTCACTGCCTGG + Intronic
1028474323 7:91236986-91237008 GCCTTTGGTCAGTGATTTACAGG - Intergenic
1029065761 7:97846717-97846739 TCCTGTGGTCAGTCACTTGAGGG - Intergenic
1030094472 7:105885701-105885723 GACTCTGGTCTCTCACTTCCAGG - Intronic
1030161537 7:106514142-106514164 GTCTTTGCTCAGGCACTTCCTGG + Intergenic
1030244712 7:107370350-107370372 GCATGAGGTCAGTAACTTCCAGG - Intronic
1031574520 7:123399507-123399529 GACTTTGGTCAGTCAGTCCCTGG + Intergenic
1031743632 7:125467368-125467390 GACTCTGGTGAGTCGCTTCTGGG + Intergenic
1031873083 7:127108680-127108702 ACCTTCAGTCAGTCACTTCCAGG + Intronic
1034539334 7:151746177-151746199 GCCTGTGGTCTCTCACTTCTAGG + Intronic
1036805986 8:11834163-11834185 TCCTCTGGCAAGTCCCTTCCAGG - Intronic
1036955131 8:13179751-13179773 GCCTCTGGTAATTAGCTTCCTGG - Intronic
1038268233 8:26052202-26052224 GCCTCCAGTCAGCCACCTCCTGG - Intergenic
1039220822 8:35328436-35328458 GACTTTGGACATTCACTTCCTGG + Intronic
1041201235 8:55453216-55453238 GCCTCTGGTCACAGCCTTCCTGG - Intronic
1042721678 8:71833192-71833214 AGCTCTGCTCAGTCACTTCAGGG - Intronic
1045983576 8:108220949-108220971 GCCTCGGTTCACTCACTCCCTGG - Intronic
1051414452 9:16824475-16824497 GCCTGTCCTCAGTCACCTCCTGG + Intronic
1053217915 9:36288256-36288278 GCCTCTGGCCATTGATTTCCAGG - Intronic
1054360611 9:64111783-64111805 TCCTCTGTTCAGGCACTGCCTGG - Intergenic
1054728170 9:68673712-68673734 GACTCTGGTCAGAGACTGCCTGG + Intergenic
1055323143 9:75101250-75101272 GCGTCAGGTCAGACATTTCCAGG + Intronic
1059334466 9:113560204-113560226 GCCACTGGACAACCACTTCCTGG + Intronic
1062570680 9:137183726-137183748 GCCTCTGGTCCGTCCTCTCCAGG + Exonic
1189630147 X:42943846-42943868 GCCTCTGGTCAAACAGTTACAGG + Intergenic
1192245109 X:69365541-69365563 GACTGTGGCCAGGCACTTCCTGG + Intergenic
1195328691 X:103778968-103778990 GCCTCTGCTTAATCACCTCCAGG + Intronic
1196306733 X:114111795-114111817 GCCTCTTGTCAGTGATTTTCAGG - Intergenic
1198466045 X:136905760-136905782 GCAACTGGTCAATCTCTTCCAGG + Intergenic
1199879547 X:151962391-151962413 GCCTCTGGAGTCTCACTTCCTGG - Intronic
1200793183 Y:7317486-7317508 GCCTGTGGGCATGCACTTCCTGG + Intergenic
1200943580 Y:8809409-8809431 ACATCTGATCAGTCATTTCCTGG - Intergenic