ID: 1129156140

View in Genome Browser
Species Human (GRCh38)
Location 15:73719394-73719416
Sequence CCGTGAAAGGAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129156140_1129156152 16 Left 1129156140 15:73719394-73719416 CCCTCCCCCTTCTCCTTTCACGG No data
Right 1129156152 15:73719433-73719455 GTGTCTCTCCCGTCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129156140 Original CRISPR CCGTGAAAGGAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr