ID: 1129158087

View in Genome Browser
Species Human (GRCh38)
Location 15:73731325-73731347
Sequence GTGGGGAAGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21225
Summary {0: 1, 1: 13, 2: 307, 3: 3642, 4: 17262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129158087_1129158102 11 Left 1129158087 15:73731325-73731347 CCCTCCCCCTTCCCCTTCCCCAC 0: 1
1: 13
2: 307
3: 3642
4: 17262
Right 1129158102 15:73731359-73731381 GACTTGTGTCCGGAATCCGTAGG 0: 1
1: 0
2: 2
3: 15
4: 164
1129158087_1129158103 18 Left 1129158087 15:73731325-73731347 CCCTCCCCCTTCCCCTTCCCCAC 0: 1
1: 13
2: 307
3: 3642
4: 17262
Right 1129158103 15:73731366-73731388 GTCCGGAATCCGTAGGTTCTCGG 0: 1
1: 1
2: 41
3: 949
4: 1056
1129158087_1129158101 1 Left 1129158087 15:73731325-73731347 CCCTCCCCCTTCCCCTTCCCCAC 0: 1
1: 13
2: 307
3: 3642
4: 17262
Right 1129158101 15:73731349-73731371 TCACGAGCTGGACTTGTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129158087 Original CRISPR GTGGGGAAGGGGAAGGGGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr