ID: 1129158368

View in Genome Browser
Species Human (GRCh38)
Location 15:73732801-73732823
Sequence AAGGAACCCCACAAAGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129158356_1129158368 28 Left 1129158356 15:73732750-73732772 CCATTTTACAGGGGTCTCCTGGG No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data
1129158360_1129158368 11 Left 1129158360 15:73732767-73732789 CCTGGGAAGGCCCCACCACTGGC No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data
1129158361_1129158368 1 Left 1129158361 15:73732777-73732799 CCCCACCACTGGCCATCGTGTGT No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data
1129158364_1129158368 -4 Left 1129158364 15:73732782-73732804 CCACTGGCCATCGTGTGTCAAGG No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data
1129158363_1129158368 -1 Left 1129158363 15:73732779-73732801 CCACCACTGGCCATCGTGTGTCA No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data
1129158362_1129158368 0 Left 1129158362 15:73732778-73732800 CCCACCACTGGCCATCGTGTGTC No data
Right 1129158368 15:73732801-73732823 AAGGAACCCCACAAAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129158368 Original CRISPR AAGGAACCCCACAAAGATCA GGG Intergenic
No off target data available for this crispr