ID: 1129162217

View in Genome Browser
Species Human (GRCh38)
Location 15:73753159-73753181
Sequence CCCGGGAGCCCGGCGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162217_1129162237 27 Left 1129162217 15:73753159-73753181 CCCTGCCCCGCCGGGCTCCCGGG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162217_1129162230 5 Left 1129162217 15:73753159-73753181 CCCTGCCCCGCCGGGCTCCCGGG No data
Right 1129162230 15:73753187-73753209 GGCCCGCTCCCCAAGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162217 Original CRISPR CCCGGGAGCCCGGCGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr