ID: 1129162226

View in Genome Browser
Species Human (GRCh38)
Location 15:73753169-73753191
Sequence GGGCCCAGGCCCCGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162226_1129162230 -5 Left 1129162226 15:73753169-73753191 CCGGGCTCCCGGGGCCTGGGCCC No data
Right 1129162230 15:73753187-73753209 GGCCCGCTCCCCAAGCGCCGCGG No data
1129162226_1129162240 27 Left 1129162226 15:73753169-73753191 CCGGGCTCCCGGGGCCTGGGCCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162226_1129162237 17 Left 1129162226 15:73753169-73753191 CCGGGCTCCCGGGGCCTGGGCCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162226 Original CRISPR GGGCCCAGGCCCCGGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr