ID: 1129162228

View in Genome Browser
Species Human (GRCh38)
Location 15:73753177-73753199
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162228_1129162240 19 Left 1129162228 15:73753177-73753199 CCGGGGCCTGGGCCCGCTCCCCA No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162228_1129162237 9 Left 1129162228 15:73753177-73753199 CCGGGGCCTGGGCCCGCTCCCCA No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162228 Original CRISPR TGGGGAGCGGGCCCAGGCCC CGG (reversed) Intergenic
No off target data available for this crispr