ID: 1129162234

View in Genome Browser
Species Human (GRCh38)
Location 15:73753196-73753218
Sequence GGCGCGGCGCCGCGGCGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162234_1129162256 28 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162234_1129162237 -10 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162234_1129162252 23 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162234_1129162240 0 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162234 Original CRISPR GGCGCGGCGCCGCGGCGCTT GGG (reversed) Intergenic