ID: 1129162235

View in Genome Browser
Species Human (GRCh38)
Location 15:73753197-73753219
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162235_1129162252 22 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162235_1129162256 27 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162235_1129162240 -1 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162235 Original CRISPR CGGCGCGGCGCCGCGGCGCT TGG (reversed) Intergenic
No off target data available for this crispr