ID: 1129162235

View in Genome Browser
Species Human (GRCh38)
Location 15:73753197-73753219
Sequence CGGCGCGGCGCCGCGGCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162235_1129162252 22 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG 0: 1
1: 0
2: 4
3: 27
4: 329
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162235_1129162240 -1 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG 0: 1
1: 0
2: 4
3: 27
4: 329
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162235_1129162256 27 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG 0: 1
1: 0
2: 4
3: 27
4: 329
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162235 Original CRISPR CGGCGCGGCGCCGCGGCGCT TGG (reversed) Intergenic